Regulog YcjW - Listeriaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By pathway - Sugar utilization

Statistics of regulated genes
Genome	Genes	Operons
Listeria innocua Clip11262	9	3
Listeria monocytogenes EGD-e	10	3
Listeria seeligeri serovar 1/2b str. SLCC3954
Listeria welshimeri serovar 6b str. SLCC5334	9	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
sucP	* Listeria innocua Clip11262 Site: position = -32 score = 6.18682 sequence = TTGTGGGAGCGCTCCCGGTT Gene: lin2973: Putative sucrose phosphorylase (EC 2.4.1.7)	2 Listeria monocytogenes EGD-e* Site: position = -32 score = 6.18682 sequence = TTGTGGGAGCGCTCCCGGTT Gene: lmo2841: Putative sucrose phosphorylase (EC 2.4.1.7) Gene: lmo2840: Putative sucrose phosphorylase (EC 2.4.1.7)	Listeria seeligeri serovar 1/2b str. SLCC3954	* Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -35 score = 6.18682 sequence = TTGTGGGAGCGCTCCCGGTT Gene: lwe2770: Putative sucrose phosphorylase (EC 2.4.1.7)	Putative sucrose phosphorylase (EC 2.4.1.7)

CRON 2.
ycjN	* Listeria innocua Clip11262 Site: position = -78 score = 5.71736 sequence = AACTGGGAGCGATTCCATAA Gene: lin2972: Sugar ABC transport system, periplasmic binding protein YcjN	* Listeria monocytogenes EGD-e Site: position = -78 score = 5.71736 sequence = AACTGGGAGCGATTCCATAA Gene: lmo2839: Sugar ABC transport system, periplasmic binding protein YcjN	Listeria seeligeri serovar 1/2b str. SLCC3954	* Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -78 score = 5.71736 sequence = AACTGGGAGCGATTCCATAA Gene: lwe2769: Sugar ABC transport system, periplasmic binding protein YcjN	Sugar ABC transport system, periplasmic binding protein YcjN
ycjO	Listeria innocua Clip11262 Gene: lin2971: Sugar ABC transport system, permease protein YcjO	Listeria monocytogenes EGD-e Gene: lmo2838: Sugar ABC transport system, permease protein YcjO	Listeria seeligeri serovar 1/2b str. SLCC3954	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe2768: Sugar ABC transport system, permease protein YcjO	Sugar ABC transport system, permease protein YcjO
ycjP	Listeria innocua Clip11262 Gene: lin2970: Sugar ABC transport system, permease protein YcjP	Listeria monocytogenes EGD-e Gene: lmo2837: Sugar ABC transport system, permease protein YcjP	Listeria seeligeri serovar 1/2b str. SLCC3954	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe2767: Sugar ABC transport system, permease protein YcjP	Sugar ABC transport system, permease protein YcjP
ycjQ	Listeria innocua Clip11262 Gene: lin2969: Zinc-type alcohol dehydrogenase YcjQ	Listeria monocytogenes EGD-e Gene: lmo2836: Zinc-type alcohol dehydrogenase YcjQ	Listeria seeligeri serovar 1/2b str. SLCC3954	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe2766: Zinc-type alcohol dehydrogenase YcjQ	Zinc-type alcohol dehydrogenase YcjQ
ycjR	Listeria innocua Clip11262 Gene: lin2968: Sugar phosphate isomerases/epimerases family protein YcjR	Listeria monocytogenes EGD-e Gene: lmo2835: Sugar phosphate isomerases/epimerases family protein YcjR	Listeria seeligeri serovar 1/2b str. SLCC3954	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe2765: Sugar phosphate isomerases/epimerases family protein YcjR	Sugar phosphate isomerases/epimerases family protein YcjR
ycjS	Listeria innocua Clip11262 Gene: lin2967: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding	Listeria monocytogenes EGD-e Gene: lmo2834: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding	Listeria seeligeri serovar 1/2b str. SLCC3954	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe2764: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding	Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding
ycjT	Listeria innocua Clip11262 Gene: lin2966: Uncharacterized sugar phosphorylase (EC 2.4.1.-)	Listeria monocytogenes EGD-e Gene: lmo2833: Uncharacterized sugar phosphorylase (EC 2.4.1.-)	Listeria seeligeri serovar 1/2b str. SLCC3954	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe2763: Uncharacterized sugar phosphorylase (EC 2.4.1.-)	Uncharacterized sugar phosphorylase (EC 2.4.1.-)

CRON 3.
ycjW	* Listeria innocua Clip11262 Site: position = -210 score = 6.18682 sequence = AACCGGGAGCGCTCCCACAA Gene: lin2974: Hypothetical sugar utilization transcriptional regulator YcjW, LacI family	* Listeria monocytogenes EGD-e Site: position = -212 score = 6.18682 sequence = AACCGGGAGCGCTCCCACAA Gene: lmo2842: Hypothetical sugar utilization transcriptional regulator YcjW, LacI family	Listeria seeligeri serovar 1/2b str. SLCC3954	* Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -214 score = 6.18682 sequence = AACCGGGAGCGCTCCCACAA Gene: lwe2771: Hypothetical sugar utilization transcriptional regulator YcjW, LacI family	Hypothetical sugar utilization transcriptional regulator YcjW, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog YcjW - Listeriaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --