Regulog YcjW - Listeriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Listeriaceae
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Listeria innocua Clip11262 | 9 | 3 |
| Listeria monocytogenes EGD-e | 10 | 3 |
| Listeria seeligeri serovar 1/2b str. SLCC3954 | ||
| Listeria welshimeri serovar 6b str. SLCC5334 | 9 | 3 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| sucP |
*
Listeria innocua Clip11262 Site: position = -32 score = 6.18682 sequence = TTGTGGGAGCGCTCCCGGTT Gene: lin2973: Putative sucrose phosphorylase (EC 2.4.1.7) |
*2
Listeria monocytogenes EGD-e Site: position = -32 score = 6.18682 sequence = TTGTGGGAGCGCTCCCGGTT Gene: lmo2841: Putative sucrose phosphorylase (EC 2.4.1.7) Gene: lmo2840: Putative sucrose phosphorylase (EC 2.4.1.7) |
|
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -35 score = 6.18682 sequence = TTGTGGGAGCGCTCCCGGTT Gene: lwe2770: Putative sucrose phosphorylase (EC 2.4.1.7) |
Putative sucrose phosphorylase (EC 2.4.1.7) |
| CRON 2. | |||||
| ycjN |
*
Listeria innocua Clip11262 Site: position = -78 score = 5.71736 sequence = AACTGGGAGCGATTCCATAA Gene: lin2972: Sugar ABC transport system, periplasmic binding protein YcjN |
*
Listeria monocytogenes EGD-e Site: position = -78 score = 5.71736 sequence = AACTGGGAGCGATTCCATAA Gene: lmo2839: Sugar ABC transport system, periplasmic binding protein YcjN |
|
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -78 score = 5.71736 sequence = AACTGGGAGCGATTCCATAA Gene: lwe2769: Sugar ABC transport system, periplasmic binding protein YcjN |
Sugar ABC transport system, periplasmic binding protein YcjN |
| ycjO |
Gene: lin2971: Sugar ABC transport system, permease protein YcjO |
Gene: lmo2838: Sugar ABC transport system, permease protein YcjO |
|
Gene: lwe2768: Sugar ABC transport system, permease protein YcjO |
Sugar ABC transport system, permease protein YcjO |
| ycjP |
Gene: lin2970: Sugar ABC transport system, permease protein YcjP |
Gene: lmo2837: Sugar ABC transport system, permease protein YcjP |
|
Gene: lwe2767: Sugar ABC transport system, permease protein YcjP |
Sugar ABC transport system, permease protein YcjP |
| ycjQ |
Gene: lin2969: Zinc-type alcohol dehydrogenase YcjQ |
Gene: lmo2836: Zinc-type alcohol dehydrogenase YcjQ |
|
Gene: lwe2766: Zinc-type alcohol dehydrogenase YcjQ |
Zinc-type alcohol dehydrogenase YcjQ |
| ycjR |
Gene: lin2968: Sugar phosphate isomerases/epimerases family protein YcjR |
Gene: lmo2835: Sugar phosphate isomerases/epimerases family protein YcjR |
|
Gene: lwe2765: Sugar phosphate isomerases/epimerases family protein YcjR |
Sugar phosphate isomerases/epimerases family protein YcjR |
| ycjS |
Gene: lin2967: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding |
Gene: lmo2834: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding |
|
Gene: lwe2764: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding |
Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding |
| ycjT |
Gene: lin2966: Uncharacterized sugar phosphorylase (EC 2.4.1.-) |
Gene: lmo2833: Uncharacterized sugar phosphorylase (EC 2.4.1.-) |
|
Gene: lwe2763: Uncharacterized sugar phosphorylase (EC 2.4.1.-) |
Uncharacterized sugar phosphorylase (EC 2.4.1.-) |
| CRON 3. | |||||
| ycjW |
*
Listeria innocua Clip11262 Site: position = -210 score = 6.18682 sequence = AACCGGGAGCGCTCCCACAA Gene: lin2974: Hypothetical sugar utilization transcriptional regulator YcjW, LacI family |
*
Listeria monocytogenes EGD-e Site: position = -212 score = 6.18682 sequence = AACCGGGAGCGCTCCCACAA Gene: lmo2842: Hypothetical sugar utilization transcriptional regulator YcjW, LacI family |
|
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -214 score = 6.18682 sequence = AACCGGGAGCGCTCCCACAA Gene: lwe2771: Hypothetical sugar utilization transcriptional regulator YcjW, LacI family |
Hypothetical sugar utilization transcriptional regulator YcjW, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |