Regulon of YcjW in Listeria innocua Clip11262

Properties
Regulator type:	Transcription factor
TF locus tag:	lin2974
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	YcjW - Listeriaceae
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -210 Score: 6.2 Sequence: AACCGGGAGCGCTCCCACAA Locus tag: lin2974 Name: ycjW Funciton: Hypothetical sugar utilization transcriptional regulator YcjW, LacI family
	lin2974	ycjW	Hypothetical sugar utilization transcriptional regulator YcjW, LacI family
Position: -32 Score: 6.2 Sequence: TTGTGGGAGCGCTCCCGGTT Locus tag: lin2973 Name: sucP Funciton: Putative sucrose phosphorylase (EC 2.4.1.7)
	lin2973	sucP	Putative sucrose phosphorylase (EC 2.4.1.7)
Position: -78 Score: 5.7 Sequence: AACTGGGAGCGATTCCATAA Locus tag: lin2972 Name: ycjN Funciton: Sugar ABC transport system, periplasmic binding protein YcjN Locus tag: lin2971 Name: ycjO Funciton: Sugar ABC transport system, permease protein YcjO Locus tag: lin2970 Name: ycjP Funciton: Sugar ABC transport system, permease protein YcjP Locus tag: lin2969 Name: ycjQ Funciton: Zinc-type alcohol dehydrogenase YcjQ Locus tag: lin2968 Name: null Funciton: Sugar phosphate isomerases/epimerases family protein YcjR Locus tag: lin2967 Name: ycjS Funciton: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding Locus tag: lin2966 Name: ycjT Funciton: Uncharacterized sugar phosphorylase (EC 2.4.1.-)
	lin2972	ycjN	Sugar ABC transport system, periplasmic binding protein YcjN
	lin2971	ycjO	Sugar ABC transport system, permease protein YcjO
	lin2970	ycjP	Sugar ABC transport system, permease protein YcjP
	lin2969	ycjQ	Zinc-type alcohol dehydrogenase YcjQ
	lin2968		Sugar phosphate isomerases/epimerases family protein YcjR
	lin2967	ycjS	Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding
	lin2966	ycjT	Uncharacterized sugar phosphorylase (EC 2.4.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD