Regulon of YcjW in Listeria welshimeri serovar 6b str. SLCC5334

Properties
Regulator type:	Transcription factor
TF locus tag:	lwe2771
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	YcjW - Listeriaceae
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -214 Score: 6.2 Sequence: AACCGGGAGCGCTCCCACAA Locus tag: lwe2771 Name: ycjW Funciton: Hypothetical sugar utilization transcriptional regulator YcjW, LacI family
	lwe2771	ycjW	Hypothetical sugar utilization transcriptional regulator YcjW, LacI family
Position: -35 Score: 6.2 Sequence: TTGTGGGAGCGCTCCCGGTT Locus tag: lwe2770 Name: sucP Funciton: Putative sucrose phosphorylase (EC 2.4.1.7)
	lwe2770	sucP	Putative sucrose phosphorylase (EC 2.4.1.7)
Position: -78 Score: 5.7 Sequence: AACTGGGAGCGATTCCATAA Locus tag: lwe2769 Name: ycjN Funciton: Sugar ABC transport system, periplasmic binding protein YcjN Locus tag: lwe2768 Name: ycjO Funciton: Sugar ABC transport system, permease protein YcjO Locus tag: lwe2767 Name: ycjP Funciton: Sugar ABC transport system, permease protein YcjP Locus tag: lwe2766 Name: ycjQ Funciton: Zinc-type alcohol dehydrogenase YcjQ Locus tag: lwe2765 Name: ycjR Funciton: Sugar phosphate isomerases/epimerases family protein YcjR Locus tag: lwe2764 Name: ycjS Funciton: Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding Locus tag: lwe2763 Name: ycjT Funciton: Uncharacterized sugar phosphorylase (EC 2.4.1.-)
	lwe2769	ycjN	Sugar ABC transport system, periplasmic binding protein YcjN
	lwe2768	ycjO	Sugar ABC transport system, permease protein YcjO
	lwe2767	ycjP	Sugar ABC transport system, permease protein YcjP
	lwe2766	ycjQ	Zinc-type alcohol dehydrogenase YcjQ
	lwe2765	ycjR	Sugar phosphate isomerases/epimerases family protein YcjR
	lwe2764	ycjS	Putative oxidoreductase YcjS (EC 1.-.-.-), NADH-binding
	lwe2763	ycjT	Uncharacterized sugar phosphorylase (EC 2.4.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD