Regulog CelR - Micrococcineae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Cellobiose utilization
Effector:	Cellobiose
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By effector - Cellobiose
By pathway - Cellobiose utilization

Statistics of regulated genes
Genome	Genes	Operons
Arthrobacter aurescens TC1	5	1
Arthrobacter chlorophenolicus A6	5	1
Arthrobacter sp. FB24
Beutenbergia cavernae DSM 12333	5	1
Brachybacterium faecium DSM 4810
Brevibacterium linens BL2
Clavibacter michiganensis subsp. michiganensis NCPPB 382
Janibacter sp. HTCC2649
Jonesia denitrificans DSM 20603	5	1
Kocuria rhizophila DC2201
Kytococcus sedentarius DSM 20547
Leifsonia xyli subsp. xyli str. CTCB07
Renibacterium salmoninarum ATCC 33209
Tropheryma whipplei str. Twist

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes															Function

CRON 1.
cebE	* Arthrobacter aurescens TC1 Site: position = -59 score = 4.93141 sequence = CTCAGAGAGCGCTCTCTCGC Site: position = -115 score = 4.64947 sequence = GTCAGAGAGCGCTCTCTTGA Gene: AAur_0088: Cellobiose specific ABC transporter, substrate-binding protein	* Arthrobacter chlorophenolicus A6 Site: position = -115 score = 6.03332 sequence = TGGTGAGAGCGCTCCCATGA Site: position = -170 score = 4.86772 sequence = CGATGGGAGCGCTCCTAAAT Site: position = -226 score = 5.89913 sequence = TGGTGGGAGCGCTCCCGTCG Gene: Achl_0399: Cellobiose specific ABC transporter, substrate-binding protein	Arthrobacter sp. FB24	* Beutenbergia cavernae DSM 12333 Site: position = -132 score = 6.14418 sequence = CCGTGAGAGCGCTCCCATGG Site: position = -96 score = 5.96195 sequence = CCTTGGGAGCGCTCTCACCA Gene: Bcav_2837: Cellobiose specific ABC transporter, substrate-binding protein	Brachybacterium faecium DSM 4810	Brevibacterium linens BL2	Clavibacter michiganensis subsp. michiganensis NCPPB 382 Gene: CMM_0086: Cellobiose specific ABC transporter, substrate-binding protein	Janibacter sp. HTCC2649	* Jonesia denitrificans DSM 20603 Site: position = -340 score = 6.08425 sequence = CGGTGGGAACGTTCCCACCG Site: position = -158 score = 5.33225 sequence = AGGTGGAAACGCTCCCACGC Site: position = -124 score = 5.60155 sequence = CGGTGGGAGCGCTACCAGAA Gene: Jden_1882: Cellobiose specific ABC transporter, substrate-binding protein	Kocuria rhizophila DC2201	Kytococcus sedentarius DSM 20547	Leifsonia xyli subsp. xyli str. CTCB07	Renibacterium salmoninarum ATCC 33209	Tropheryma whipplei str. Twist	Cellobiose specific ABC transporter, substrate-binding protein
cebF	Arthrobacter aurescens TC1 Gene: AAur_0087: Cellobiose specific ABC transporter, permease protein 1	Arthrobacter chlorophenolicus A6 Gene: Achl_0400: Cellobiose specific ABC transporter, permease protein 1	Arthrobacter sp. FB24	Beutenbergia cavernae DSM 12333 Gene: Bcav_2838: Cellobiose specific ABC transporter, permease protein 1	Brachybacterium faecium DSM 4810	Brevibacterium linens BL2	Clavibacter michiganensis subsp. michiganensis NCPPB 382 Gene: CMM_0085: Cellobiose specific ABC transporter, permease protein 1	Janibacter sp. HTCC2649	Jonesia denitrificans DSM 20603 Gene: Jden_1881: Cellobiose specific ABC transporter, permease protein 1	Kocuria rhizophila DC2201	Kytococcus sedentarius DSM 20547	Leifsonia xyli subsp. xyli str. CTCB07	Renibacterium salmoninarum ATCC 33209	Tropheryma whipplei str. Twist	Cellobiose specific ABC transporter, permease protein 1
cebG	Arthrobacter aurescens TC1 Gene: AAur_0086: Cellobiose specific ABC transporter, permease protein 2	Arthrobacter chlorophenolicus A6 Gene: Achl_0401: Cellobiose specific ABC transporter, permease protein 2	Arthrobacter sp. FB24	Beutenbergia cavernae DSM 12333 Gene: Bcav_2839: Cellobiose specific ABC transporter, permease protein 2	Brachybacterium faecium DSM 4810	Brevibacterium linens BL2	Clavibacter michiganensis subsp. michiganensis NCPPB 382 Gene: CMM_0084: Cellobiose specific ABC transporter, permease protein 2	Janibacter sp. HTCC2649	Jonesia denitrificans DSM 20603 Gene: Jden_1880: Cellobiose specific ABC transporter, permease protein 2	Kocuria rhizophila DC2201	Kytococcus sedentarius DSM 20547	Leifsonia xyli subsp. xyli str. CTCB07	Renibacterium salmoninarum ATCC 33209	Tropheryma whipplei str. Twist	Cellobiose specific ABC transporter, permease protein 2
bglC	Arthrobacter aurescens TC1 Gene: AAur_0085: Beta-glucosidase (EC 3.2.1.21)	Arthrobacter chlorophenolicus A6 Gene: Achl_0402: Beta-glucosidase (EC 3.2.1.21)	Arthrobacter sp. FB24	Beutenbergia cavernae DSM 12333 Gene: Bcav_2840: Beta-glucosidase (EC 3.2.1.21)	Brachybacterium faecium DSM 4810	Brevibacterium linens BL2	Clavibacter michiganensis subsp. michiganensis NCPPB 382	Janibacter sp. HTCC2649	Jonesia denitrificans DSM 20603 Gene: Jden_1879: Beta-glucosidase (EC 3.2.1.21)	Kocuria rhizophila DC2201	Kytococcus sedentarius DSM 20547	Leifsonia xyli subsp. xyli str. CTCB07	Renibacterium salmoninarum ATCC 33209	Tropheryma whipplei str. Twist	Beta-glucosidase (EC 3.2.1.21)
celR	Arthrobacter aurescens TC1 Gene: AAur_0084: Cellobiose utilization transcriptional regulator CelR, LacI family	Arthrobacter chlorophenolicus A6 Gene: Achl_0403: Cellobiose utilization transcriptional regulator CelR, LacI family	Arthrobacter sp. FB24	Beutenbergia cavernae DSM 12333 Gene: Bcav_2841: Cellobiose utilization transcriptional regulator CelR, LacI family	Brachybacterium faecium DSM 4810	Brevibacterium linens BL2	Clavibacter michiganensis subsp. michiganensis NCPPB 382	Janibacter sp. HTCC2649	Jonesia denitrificans DSM 20603 Gene: Jden_1878: Cellobiose utilization transcriptional regulator CelR, LacI family	Kocuria rhizophila DC2201	Kytococcus sedentarius DSM 20547	Leifsonia xyli subsp. xyli str. CTCB07	Renibacterium salmoninarum ATCC 33209	Tropheryma whipplei str. Twist	Cellobiose utilization transcriptional regulator CelR, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CelR - Micrococcineae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --