Regulog CelR - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By TF family - LacI
- By effector - Cellobiose
- By pathway - Cellobiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Arthrobacter aurescens TC1 | 5 | 1 |
| Arthrobacter chlorophenolicus A6 | 5 | 1 |
| Arthrobacter sp. FB24 | ||
| Beutenbergia cavernae DSM 12333 | 5 | 1 |
| Brachybacterium faecium DSM 4810 | ||
| Brevibacterium linens BL2 | ||
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||
| Janibacter sp. HTCC2649 | ||
| Jonesia denitrificans DSM 20603 | 5 | 1 |
| Kocuria rhizophila DC2201 | ||
| Kytococcus sedentarius DSM 20547 | ||
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Renibacterium salmoninarum ATCC 33209 | ||
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| cebE |
*
Arthrobacter aurescens TC1 Site: position = -59 score = 4.93141 sequence = CTCAGAGAGCGCTCTCTCGC Site: position = -115 score = 4.64947 sequence = GTCAGAGAGCGCTCTCTTGA Gene: AAur_0088: Cellobiose specific ABC transporter, substrate-binding protein |
*
Arthrobacter chlorophenolicus A6 Site: position = -115 score = 6.03332 sequence = TGGTGAGAGCGCTCCCATGA Site: position = -170 score = 4.86772 sequence = CGATGGGAGCGCTCCTAAAT Site: position = -226 score = 5.89913 sequence = TGGTGGGAGCGCTCCCGTCG Gene: Achl_0399: Cellobiose specific ABC transporter, substrate-binding protein |
|
*
Beutenbergia cavernae DSM 12333 Site: position = -132 score = 6.14418 sequence = CCGTGAGAGCGCTCCCATGG Site: position = -96 score = 5.96195 sequence = CCTTGGGAGCGCTCTCACCA Gene: Bcav_2837: Cellobiose specific ABC transporter, substrate-binding protein |
|
|
Gene: CMM_0086: Cellobiose specific ABC transporter, substrate-binding protein |
|
*
Jonesia denitrificans DSM 20603 Site: position = -340 score = 6.08425 sequence = CGGTGGGAACGTTCCCACCG Site: position = -158 score = 5.33225 sequence = AGGTGGAAACGCTCCCACGC Site: position = -124 score = 5.60155 sequence = CGGTGGGAGCGCTACCAGAA Gene: Jden_1882: Cellobiose specific ABC transporter, substrate-binding protein |
|
|
|
|
|
Cellobiose specific ABC transporter, substrate-binding protein |
| cebF |
Gene: AAur_0087: Cellobiose specific ABC transporter, permease protein 1 |
Gene: Achl_0400: Cellobiose specific ABC transporter, permease protein 1 |
|
Gene: Bcav_2838: Cellobiose specific ABC transporter, permease protein 1 |
|
|
Gene: CMM_0085: Cellobiose specific ABC transporter, permease protein 1 |
|
Gene: Jden_1881: Cellobiose specific ABC transporter, permease protein 1 |
|
|
|
|
|
Cellobiose specific ABC transporter, permease protein 1 |
| cebG |
Gene: AAur_0086: Cellobiose specific ABC transporter, permease protein 2 |
Gene: Achl_0401: Cellobiose specific ABC transporter, permease protein 2 |
|
Gene: Bcav_2839: Cellobiose specific ABC transporter, permease protein 2 |
|
|
Gene: CMM_0084: Cellobiose specific ABC transporter, permease protein 2 |
|
Gene: Jden_1880: Cellobiose specific ABC transporter, permease protein 2 |
|
|
|
|
|
Cellobiose specific ABC transporter, permease protein 2 |
| bglC |
Gene: AAur_0085: Beta-glucosidase (EC 3.2.1.21) |
Gene: Achl_0402: Beta-glucosidase (EC 3.2.1.21) |
|
Gene: Bcav_2840: Beta-glucosidase (EC 3.2.1.21) |
|
|
|
|
Gene: Jden_1879: Beta-glucosidase (EC 3.2.1.21) |
|
|
|
|
|
Beta-glucosidase (EC 3.2.1.21) |
| celR |
Gene: AAur_0084: Cellobiose utilization transcriptional regulator CelR, LacI family |
Gene: Achl_0403: Cellobiose utilization transcriptional regulator CelR, LacI family |
|
Gene: Bcav_2841: Cellobiose utilization transcriptional regulator CelR, LacI family |
|
|
|
|
Gene: Jden_1878: Cellobiose utilization transcriptional regulator CelR, LacI family |
|
|
|
|
|
Cellobiose utilization transcriptional regulator CelR, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |