Regulon of CelR in Beutenbergia cavernae DSM 12333

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcav_2841
Regulator family:	LacI
Regulation mode:
Biological process:	Cellobiose utilization
Effector:	Cellobiose
Regulog:	CelR - Micrococcineae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By effector - Cellobiose
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -132 Score: 6.1 Sequence: CCGTGAGAGCGCTCCCATGG Position: -96 Score: 6 Sequence: CCTTGGGAGCGCTCTCACCA Locus tag: Bcav_2837 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: Bcav_2838 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: Bcav_2839 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2 Locus tag: Bcav_2840 Name: bglC Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: Bcav_2841 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
	Bcav_2837	cebE	Cellobiose specific ABC transporter, substrate-binding protein
	Bcav_2838	cebF	Cellobiose specific ABC transporter, permease protein 1
	Bcav_2839	cebG	Cellobiose specific ABC transporter, permease protein 2
	Bcav_2840	bglC	Beta-glucosidase (EC 3.2.1.21)
	Bcav_2841	celR	Cellobiose utilization transcriptional regulator CelR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD