Regulon of CelR in Arthrobacter aurescens TC1

Properties
Regulator type:	Transcription factor
TF locus tag:	AAur_0084
Regulator family:	LacI
Regulation mode:
Biological process:	Cellobiose utilization
Effector:	Cellobiose
Regulog:	CelR - Micrococcineae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By effector - Cellobiose
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -115 Score: 4.6 Sequence: GTCAGAGAGCGCTCTCTTGA Position: -59 Score: 4.9 Sequence: CTCAGAGAGCGCTCTCTCGC Locus tag: AAur_0088 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: AAur_0087 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: AAur_0086 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2 Locus tag: AAur_0085 Name: bglC Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: AAur_0084 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
	AAur_0088	cebE	Cellobiose specific ABC transporter, substrate-binding protein
	AAur_0087	cebF	Cellobiose specific ABC transporter, permease protein 1
	AAur_0086	cebG	Cellobiose specific ABC transporter, permease protein 2
	AAur_0085	bglC	Beta-glucosidase (EC 3.2.1.21)
	AAur_0084	celR	Cellobiose utilization transcriptional regulator CelR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD