Regulog Caur_3401 - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - TetR
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus aggregans DSM 9485 | 3 | 1 |
| Chloroflexus sp. Y-400-fl | 2 | 1 |
| Herpetosiphon aurantiacus ATCC 23779 | ||
| Roseiflexus castenholzii DSM 13941 | 2 | 1 |
| Roseiflexus sp. RS-1 | 2 | 1 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| acrB |
*
Chloroflexus aggregans DSM 9485 Site: position = -69 score = 7.02989 sequence = ACTTTACGGTATAGTAAAAA Gene: Cagg_0354: Probable multidrug efflux system from RND family, AcrB pore domain |
*
Chloroflexus sp. Y-400-fl Site: position = -69 score = 7.02989 sequence = ACTTTACGGTATAGTAAAAA Gene: Chy400_3664: Probable multidrug efflux system from RND family, AcrB pore domain |
|
*
Roseiflexus castenholzii DSM 13941 Site: position = -156 score = 6.61776 sequence = ATTTTACTGTATAGTAGTCT Gene: Rcas_4170: Probable multidrug efflux system from RND family, AcrB pore domain |
*
Roseiflexus sp. RS-1 Site: position = -136 score = 6.61776 sequence = ATTTTACTGTATAGTAGTCT Gene: RoseRS_4303: Probable multidrug efflux system from RND family, AcrB pore domain |
Probable multidrug efflux system from RND family, AcrB pore domain |
| hlyD |
Gene: Cagg_0355: secretion protein HlyD family protein |
Gene: Chy400_3663: secretion protein HlyD family protein |
|
Gene: Rcas_4169: secretion protein HlyD family protein |
Gene: RoseRS_4302: secretion protein HlyD family protein |
secretion protein HlyD family protein |
| Caur_3401 |
Gene: Cagg_0356: Predicted transcriptional regulator of multidrug efflux transporter, TetR family |
|
|
Gene: Rcas_4171: Predicted transcriptional regulator of multidrug efflux transporter, TetR family |
Gene: RoseRS_4304: Predicted transcriptional regulator of multidrug efflux transporter, TetR family |
Predicted transcriptional regulator of multidrug efflux transporter, TetR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |