Regulon of Caur_3401 in Chloroflexus sp. Y-400-fl
Regulator type: | Transcription factor |
TF locus tag: | |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Multidrug resistance; Multidrug efflux |
Effector: | |
Regulog: | Caur_3401 - Chloroflexia |
Statistics of regulated genes: | |
- Genes | 2 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - TetR
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
Locus Tag | Name | Function | |
---|---|---|---|
Position: -69
Score: 7 Sequence: ACTTTACGGTATAGTAAAAA
Locus tag: Chy400_3664
Name: acrB Funciton: Probable multidrug efflux system from RND family, AcrB pore domain
Locus tag: Chy400_3663
Name: hlyD Funciton: secretion protein HlyD family protein |
|||
acrB
|
Probable multidrug efflux system from RND family, AcrB pore domain
|
||
hlyD
|
secretion protein HlyD family protein
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |