Regulon of Caur_3401 in Roseiflexus sp. RS-1
| Regulator type: | Transcription factor |
| TF locus tag: | RoseRS_4304 |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Regulog: | Caur_3401 - Chloroflexia |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - TetR
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -136
Score: 6.6 Sequence: ATTTTACTGTATAGTAGTCT
Locus tag: RoseRS_4303
Name: acrB Funciton: Probable multidrug efflux system from RND family, AcrB pore domain
Locus tag: RoseRS_4302
Name: hlyD Funciton: secretion protein HlyD family protein |
|||
|
acrB
|
Probable multidrug efflux system from RND family, AcrB pore domain
|
||
|
hlyD
|
secretion protein HlyD family protein
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |