Regulon of Caur_3401 in Roseiflexus sp. RS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	RoseRS_4304
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	Caur_3401 - Chloroflexia
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - TetR
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -136 Score: 6.6 Sequence: ATTTTACTGTATAGTAGTCT Locus tag: RoseRS_4303 Name: acrB Funciton: Probable multidrug efflux system from RND family, AcrB pore domain Locus tag: RoseRS_4302 Name: hlyD Funciton: secretion protein HlyD family protein
	RoseRS_4303	acrB	Probable multidrug efflux system from RND family, AcrB pore domain
	RoseRS_4302	hlyD	secretion protein HlyD family protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD