Regulog Caur_3866 - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - LacI
- By effector - Beta-glucoside
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus aggregans DSM 9485 | 14 | 1 |
| Chloroflexus sp. Y-400-fl | 14 | 1 |
| Herpetosiphon aurantiacus ATCC 23779 | ||
| Roseiflexus castenholzii DSM 13941 | ||
| Roseiflexus sp. RS-1 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| COG3459 |
*
Chloroflexus aggregans DSM 9485 Site: position = -77 score = 4.89623 sequence = AAAGTGAAACATTTCACCGA Site: position = 103 score = 5.98688 sequence = TTTGTGAAACGTTTCATCCA Site: position = -3 score = 5.88396 sequence = TTTATGAAACGTTACACTCT Gene: Cagg_0091: Cellobiose phosphorylase |
*
Chloroflexus sp. Y-400-fl Site: position = -88 score = 6.1064 sequence = GTAATGAAACGTTTCATACC Site: position = -193 score = 5.91494 sequence = CGTATGAAACGTTACACAAA Gene: Chy400_4165: Cellobiose phosphorylase |
|
|
|
Cellobiose phosphorylase |
| Caur_3857 |
Gene: Cagg_0090: Putative sugar ABC transporter, solute-binding component |
Gene: Chy400_4166: Putative sugar ABC transporter, solute-binding component |
|
|
|
Putative sugar ABC transporter, solute-binding component |
| Caur_3858 |
Gene: Cagg_0089: Putative sugar ABC transporter, solute-binding component |
Gene: Chy400_4167: Putative sugar ABC transporter, solute-binding component |
|
|
|
Putative sugar ABC transporter, solute-binding component |
| Caur_3859 |
Gene: Cagg_0088: Putative sugar ABC transporter, inner membrane component |
Gene: Chy400_4168: Putative sugar ABC transporter, inner membrane component |
|
|
|
Putative sugar ABC transporter, inner membrane component |
| Caur_3860 |
Gene: Cagg_0087: Putative sugar ABC transporter, inner membrane component |
Gene: Chy400_4169: Putative sugar ABC transporter, inner membrane component |
|
|
|
Putative sugar ABC transporter, inner membrane component |
| tolB |
Gene: Cagg_0086: Hypothetical six-bladed beta-propeller, TolB-like protein |
Gene: Chy400_4170: Hypothetical six-bladed beta-propeller, TolB-like protein |
|
|
|
Hypothetical six-bladed beta-propeller, TolB-like protein |
| Caur_3862 |
Gene: Cagg_0085: hypothetical protein |
Gene: Chy400_4171: hypothetical protein |
|
|
|
hypothetical protein |
| Caur_3863 |
Gene: Cagg_0084: Putative sugar ABC transporter, inner membrane component |
Gene: Chy400_4172: Putative sugar ABC transporter, inner membrane component |
|
|
|
Putative sugar ABC transporter, inner membrane component |
| Caur_3864 |
Gene: Cagg_0083: Putative sugar ABC transporter, inner membrane component |
Gene: Chy400_4173: Putative sugar ABC transporter, inner membrane component |
|
|
|
Putative sugar ABC transporter, inner membrane component |
| COG5368 |
Gene: Cagg_0082: conserved hypothetical protein |
Gene: Chy400_4174: conserved hypothetical protein |
|
|
|
conserved hypothetical protein |
| bglR |
Gene: Cagg_0081: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family |
Gene: Chy400_4175: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family |
|
|
|
Putative beta-glucoside utilization pathway transcriptional regulator, LacI family |
| Caur_3867 |
Gene: Cagg_0080: conserved hypothetical protein |
Gene: Chy400_4176: conserved hypothetical protein |
|
|
|
conserved hypothetical protein |
| GH35 |
Gene: Cagg_0079: glycoside hydrolase family 35 |
Gene: Chy400_4177: glycoside hydrolase family 35 |
|
|
|
glycoside hydrolase family 35 |
| bglX |
Gene: Cagg_0078: Beta-glucosidase-related glycosidase |
Gene: Chy400_4178: Beta-glucosidase-related glycosidase |
|
|
|
Beta-glucosidase-related glycosidase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |