Statistics of regulated genes

Genome	Genes	Operons
Chloroflexus aggregans DSM 9485	14	1
Chloroflexus sp. Y-400-fl	14	1
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941
Roseiflexus sp. RS-1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes						Function
CRON 1.
COG3459	* Chloroflexus aggregans DSM 9485 Site: position = -77 score = 4.89623 sequence = AAAGTGAAACATTTCACCGA Site: position = 103 score = 5.98688 sequence = TTTGTGAAACGTTTCATCCA Site: position = -3 score = 5.88396 sequence = TTTATGAAACGTTACACTCT Gene: Cagg_0091: Cellobiose phosphorylase	* Chloroflexus sp. Y-400-fl Site: position = -88 score = 6.1064 sequence = GTAATGAAACGTTTCATACC Site: position = -193 score = 5.91494 sequence = CGTATGAAACGTTACACAAA Gene: Chy400_4165: Cellobiose phosphorylase	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Cellobiose phosphorylase
Caur_3857	Chloroflexus aggregans DSM 9485 Gene: Cagg_0090: Putative sugar ABC transporter, solute-binding component	Chloroflexus sp. Y-400-fl Gene: Chy400_4166: Putative sugar ABC transporter, solute-binding component	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Putative sugar ABC transporter, solute-binding component
Caur_3858	Chloroflexus aggregans DSM 9485 Gene: Cagg_0089: Putative sugar ABC transporter, solute-binding component	Chloroflexus sp. Y-400-fl Gene: Chy400_4167: Putative sugar ABC transporter, solute-binding component	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Putative sugar ABC transporter, solute-binding component
Caur_3859	Chloroflexus aggregans DSM 9485 Gene: Cagg_0088: Putative sugar ABC transporter, inner membrane component	Chloroflexus sp. Y-400-fl Gene: Chy400_4168: Putative sugar ABC transporter, inner membrane component	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Putative sugar ABC transporter, inner membrane component
Caur_3860	Chloroflexus aggregans DSM 9485 Gene: Cagg_0087: Putative sugar ABC transporter, inner membrane component	Chloroflexus sp. Y-400-fl Gene: Chy400_4169: Putative sugar ABC transporter, inner membrane component	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Putative sugar ABC transporter, inner membrane component
tolB	Chloroflexus aggregans DSM 9485 Gene: Cagg_0086: Hypothetical six-bladed beta-propeller, TolB-like protein	Chloroflexus sp. Y-400-fl Gene: Chy400_4170: Hypothetical six-bladed beta-propeller, TolB-like protein	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Hypothetical six-bladed beta-propeller, TolB-like protein
Caur_3862	Chloroflexus aggregans DSM 9485 Gene: Cagg_0085: hypothetical protein	Chloroflexus sp. Y-400-fl Gene: Chy400_4171: hypothetical protein	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	hypothetical protein
Caur_3863	Chloroflexus aggregans DSM 9485 Gene: Cagg_0084: Putative sugar ABC transporter, inner membrane component	Chloroflexus sp. Y-400-fl Gene: Chy400_4172: Putative sugar ABC transporter, inner membrane component	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Putative sugar ABC transporter, inner membrane component
Caur_3864	Chloroflexus aggregans DSM 9485 Gene: Cagg_0083: Putative sugar ABC transporter, inner membrane component	Chloroflexus sp. Y-400-fl Gene: Chy400_4173: Putative sugar ABC transporter, inner membrane component	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Putative sugar ABC transporter, inner membrane component
COG5368	Chloroflexus aggregans DSM 9485 Gene: Cagg_0082: conserved hypothetical protein	Chloroflexus sp. Y-400-fl Gene: Chy400_4174: conserved hypothetical protein	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	conserved hypothetical protein
bglR	Chloroflexus aggregans DSM 9485 Gene: Cagg_0081: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family	Chloroflexus sp. Y-400-fl Gene: Chy400_4175: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Putative beta-glucoside utilization pathway transcriptional regulator, LacI family
Caur_3867	Chloroflexus aggregans DSM 9485 Gene: Cagg_0080: conserved hypothetical protein	Chloroflexus sp. Y-400-fl Gene: Chy400_4176: conserved hypothetical protein	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	conserved hypothetical protein
GH35	Chloroflexus aggregans DSM 9485 Gene: Cagg_0079: glycoside hydrolase family 35	Chloroflexus sp. Y-400-fl Gene: Chy400_4177: glycoside hydrolase family 35	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	glycoside hydrolase family 35
bglX	Chloroflexus aggregans DSM 9485 Gene: Cagg_0078: Beta-glucosidase-related glycosidase	Chloroflexus sp. Y-400-fl Gene: Chy400_4178: Beta-glucosidase-related glycosidase	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Beta-glucosidase-related glycosidase

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD