Regulon of Caur_3866 in Chloroflexus sp. Y-400-fl

Properties
Regulator type:	Transcription factor
TF locus tag:	Chy400_4175
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	Caur_3866 - Chloroflexia
Statistics of regulated genes:
- Genes	14
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -193 Score: 5.9 Sequence: CGTATGAAACGTTACACAAA Position: -88 Score: 6.1 Sequence: GTAATGAAACGTTTCATACC Locus tag: Chy400_4165 Name: COG3459 Funciton: Cellobiose phosphorylase Locus tag: Chy400_4166 Name: Caur_3857 Funciton: Putative sugar ABC transporter, solute-binding component Locus tag: Chy400_4167 Name: Caur_3858 Funciton: Putative sugar ABC transporter, solute-binding component Locus tag: Chy400_4168 Name: Caur_3859 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Chy400_4169 Name: Caur_3860 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Chy400_4170 Name: tolB Funciton: Hypothetical six-bladed beta-propeller, TolB-like protein Locus tag: Chy400_4171 Name: Caur_3862 Funciton: hypothetical protein Locus tag: Chy400_4172 Name: Caur_3863 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Chy400_4173 Name: Caur_3864 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Chy400_4174 Name: COG5368 Funciton: conserved hypothetical protein Locus tag: Chy400_4175 Name: bglR Funciton: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family Locus tag: Chy400_4176 Name: Caur_3867 Funciton: conserved hypothetical protein Locus tag: Chy400_4177 Name: GH35 Funciton: glycoside hydrolase family 35 Locus tag: Chy400_4178 Name: bglX Funciton: Beta-glucosidase-related glycosidase
	Chy400_4165	COG3459	Cellobiose phosphorylase
	Chy400_4166	Caur_3857	Putative sugar ABC transporter, solute-binding component
	Chy400_4167	Caur_3858	Putative sugar ABC transporter, solute-binding component
	Chy400_4168	Caur_3859	Putative sugar ABC transporter, inner membrane component
	Chy400_4169	Caur_3860	Putative sugar ABC transporter, inner membrane component
	Chy400_4170	tolB	Hypothetical six-bladed beta-propeller, TolB-like protein
	Chy400_4171	Caur_3862	hypothetical protein
	Chy400_4172	Caur_3863	Putative sugar ABC transporter, inner membrane component
	Chy400_4173	Caur_3864	Putative sugar ABC transporter, inner membrane component
	Chy400_4174	COG5368	conserved hypothetical protein
	Chy400_4175	bglR	Putative beta-glucoside utilization pathway transcriptional regulator, LacI family
	Chy400_4176	Caur_3867	conserved hypothetical protein
	Chy400_4177	GH35	glycoside hydrolase family 35
	Chy400_4178	bglX	Beta-glucosidase-related glycosidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD