Regulon of Caur_3866 in Chloroflexus aggregans DSM 9485

Properties
Regulator type:	Transcription factor
TF locus tag:	Cagg_0081
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	Caur_3866 - Chloroflexia
Statistics of regulated genes:
- Genes	14
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 4.9 Sequence: AAAGTGAAACATTTCACCGA Position: -3 Score: 5.9 Sequence: TTTATGAAACGTTACACTCT Position: 103 Score: 6 Sequence: TTTGTGAAACGTTTCATCCA Locus tag: Cagg_0091 Name: COG3459 Funciton: Cellobiose phosphorylase Locus tag: Cagg_0090 Name: Caur_3857 Funciton: Putative sugar ABC transporter, solute-binding component Locus tag: Cagg_0089 Name: Caur_3858 Funciton: Putative sugar ABC transporter, solute-binding component Locus tag: Cagg_0088 Name: Caur_3859 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Cagg_0087 Name: Caur_3860 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Cagg_0086 Name: tolB Funciton: Hypothetical six-bladed beta-propeller, TolB-like protein Locus tag: Cagg_0085 Name: Caur_3862 Funciton: hypothetical protein Locus tag: Cagg_0084 Name: Caur_3863 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Cagg_0083 Name: Caur_3864 Funciton: Putative sugar ABC transporter, inner membrane component Locus tag: Cagg_0082 Name: COG5368 Funciton: conserved hypothetical protein Locus tag: Cagg_0081 Name: bglR Funciton: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family Locus tag: Cagg_0080 Name: Caur_3867 Funciton: conserved hypothetical protein Locus tag: Cagg_0079 Name: GH35 Funciton: glycoside hydrolase family 35 Locus tag: Cagg_0078 Name: bglX Funciton: Beta-glucosidase-related glycosidase
	Cagg_0091	COG3459	Cellobiose phosphorylase
	Cagg_0090	Caur_3857	Putative sugar ABC transporter, solute-binding component
	Cagg_0089	Caur_3858	Putative sugar ABC transporter, solute-binding component
	Cagg_0088	Caur_3859	Putative sugar ABC transporter, inner membrane component
	Cagg_0087	Caur_3860	Putative sugar ABC transporter, inner membrane component
	Cagg_0086	tolB	Hypothetical six-bladed beta-propeller, TolB-like protein
	Cagg_0085	Caur_3862	hypothetical protein
	Cagg_0084	Caur_3863	Putative sugar ABC transporter, inner membrane component
	Cagg_0083	Caur_3864	Putative sugar ABC transporter, inner membrane component
	Cagg_0082	COG5368	conserved hypothetical protein
	Cagg_0081	bglR	Putative beta-glucoside utilization pathway transcriptional regulator, LacI family
	Cagg_0080	Caur_3867	conserved hypothetical protein
	Cagg_0079	GH35	glycoside hydrolase family 35
	Cagg_0078	bglX	Beta-glucosidase-related glycosidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD