Regulog CelR2 - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By effector - Cellobiose-6-phosphate
- By pathway - Cellobiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | ||
| Salmonella typhimurium LT2 | ||
| Serratia proteamaculans 568 | 3 | 1 |
| Yersinia pestis KIM | 2 | 1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| celA2 |
Gene: CKO_03000: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
|
Gene: Ent638_0199: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
|
|
|
Gene: KPN_04368: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
Gene: plu2756: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
|
|
*
Serratia proteamaculans 568 Site: position = -96 score = 7.74597 sequence = AAATGAGAGCGCTCTCATTT Gene: Spro_4590: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
|
PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
| bglA |
|
|
|
|
|
|
|
Gene: plu2757: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
|
Gene: Spro_4591: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
*
Yersinia pestis KIM Site: position = -210 score = 7.74597 sequence = AAATGAGAGCGCTCTCATTT Gene: y3950: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
6-phospho-beta-glucosidase (EC 3.2.1.86) |
| celR2 |
|
|
|
|
|
|
|
|
|
|
Gene: Spro_4592: Transcriptional regulator for cellobiose utilization, LacI family |
Gene: y3949: Transcriptional regulator for cellobiose utilization, LacI family |
Transcriptional regulator for cellobiose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |