Regulon of CelR2 in Serratia proteamaculans 568

Properties
Regulator type:	Transcription factor
TF locus tag:	Spro_4592
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	Cellobiose-6-phosphate
Regulog:	CelR2 - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Cellobiose-6-phosphate
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -96 Score: 7.7 Sequence: AAATGAGAGCGCTCTCATTT Locus tag: Spro_4590 Name: celA2 Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) Locus tag: Spro_4591 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: Spro_4592 Name: celR2 Funciton: Transcriptional regulator for cellobiose utilization, LacI family
	Spro_4590	celA2	PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
	Spro_4591	bglA	6-phospho-beta-glucosidase (EC 3.2.1.86)
	Spro_4592	celR2	Transcriptional regulator for cellobiose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD