Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing celA2 gene

Properties
Regulog: CelR2 - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Phylum: Proteobacteria/gamma
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Serratia proteamaculans 568
Position: -96
Score: 7.74597
Sequence: AAATGAGAGCGCTCTCATTT
Locus tag: Spro_4590
Name: celA2
Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
Locus tag: Spro_4591
Name: bglA
Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: Spro_4592
Name: celR2
Funciton: Transcriptional regulator for cellobiose utilization, LacI family
celA2-bglA-celR2 -96 7.7 AAATGAGAGCGCTCTCATTT Spro_4590