Regulog YtrA - Listeriaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Listeriaceae
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Listeria innocua Clip11262 | 3 | 1 |
| Listeria monocytogenes EGD-e | 3 | 1 |
| Listeria seeligeri serovar 1/2b str. SLCC3954 | 3 | 1 |
| Listeria welshimeri serovar 6b str. SLCC5334 | 3 | 1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| ytrA |
*
Listeria innocua Clip11262 Site: position = -66 score = 6.99647 sequence = TACTGTACTATTATAACTAGTACAATT Gene: lin2343: Transcriptional regulator, GntR family |
*
Listeria monocytogenes EGD-e Site: position = -65 score = 6.84439 sequence = TACTGTACTATAGTAACTAGTACAATT Gene: lmo2241: Transcriptional regulator, GntR family |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -64 score = 7.16979 sequence = TAGTGTACTATTATAACTAGTACAATT Gene: lse_2221: Transcriptional regulator, GntR family |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -60 score = 6.96286 sequence = CAGTGTACTATTGTAACTAGTACAATT Gene: lwe2258: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| ytrB |
Gene: lin2342: ABC transporter, ATP-binding protein |
Gene: lmo2240: ABC transporter, ATP-binding protein |
Gene: lse_2220: ABC transporter, ATP-binding protein |
Gene: lwe2257: ABC transporter, ATP-binding protein |
ABC transporter, ATP-binding protein |
| ytrC |
Gene: lin2341: ABC transporter permease protein |
Gene: lmo2239: ABC transporter permease protein |
Gene: lse_2219: ABC transporter permease protein |
Gene: lwe2256: ABC transporter permease protein |
ABC transporter permease protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |