Regulon of YtrA in Listeria seeligeri serovar 1/2b str. SLCC3954

Properties
Regulator type:	Transcription factor
TF locus tag:	lse_2221
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YtrA - Listeriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 7.2 Sequence: TAGTGTACTATTATAACTAGTACAATT Locus tag: lse_2221 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: lse_2220 Name: ytrB Funciton: ABC transporter, ATP-binding protein Locus tag: lse_2219 Name: ytrC Funciton: ABC transporter permease protein
	lse_2221	ytrA	Transcriptional regulator, GntR family
	lse_2220	ytrB	ABC transporter, ATP-binding protein
	lse_2219	ytrC	ABC transporter permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD