Regulon of YtrA in Listeria innocua Clip11262

Properties
Regulator type:	Transcription factor
TF locus tag:	lin2343
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YtrA - Listeriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 7 Sequence: TACTGTACTATTATAACTAGTACAATT Locus tag: lin2343 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: lin2342 Name: ytrB Funciton: ABC transporter, ATP-binding protein Locus tag: lin2341 Name: ytrC Funciton: ABC transporter permease protein
	lin2343	ytrA	Transcriptional regulator, GntR family
	lin2342	ytrB	ABC transporter, ATP-binding protein
	lin2341	ytrC	ABC transporter permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD