Regulog ScrR - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By TF family - LacI
- By effector - Sucrose
- By pathway - Sucrose utilization
| Genome | Genes | Operons |
|---|---|---|
| Azotobacter vinelandii AvOP | 3 | 2 |
| Pseudomonas aeruginosa PAO1 | ||
| Pseudomonas entomophila L48 | ||
| Pseudomonas fluorescens Pf-5 | 4 | 2 |
| Pseudomonas mendocina ymp | ||
| Pseudomonas putida KT2440 | ||
| Pseudomonas stutzeri A1501 | ||
| Pseudomonas syringae pv. tomato str. DC3000 | 7 | 2 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| scrY |
*
Azotobacter vinelandii AvOP Site: position = -241 score = 5.1791 sequence = TTGAGGTAACGTTAACATCG Gene: Avin_51790: Sucrose-specific outer membrane porin |
|
|
*
Pseudomonas fluorescens Pf-5 Site: position = -185 score = 5.58221 sequence = TTAGGTTAACGTTAACATCG Gene: PFL_3239: Sucrose-specific outer membrane porin |
|
|
|
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -96 score = 6.3774 sequence = AAAAGTTAACGTTAACATCG Gene: PSPTO0890: Sucrose-specific outer membrane porin |
Sucrose-specific outer membrane porin |
| CRON 2. | |||||||||
| aglE |
|
|
|
|
|
|
|
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -46 score = 6.3774 sequence = CGATGTTAACGTTAACTTTT Gene: PSPTO0889: Alpha-glucoside ABC transporter periplasmic sugar-binding protein |
Alpha-glucoside ABC transporter periplasmic sugar-binding protein |
| aglF |
|
|
|
|
|
|
|
Gene: PSPTO0888: Alpha-glucoside ABC transporter permease protein |
Alpha-glucoside ABC transporter permease protein |
| aglG |
|
|
|
|
|
|
|
Gene: PSPTO0887: Alpha-glucoside ABC transporter permease protein |
Alpha-glucoside ABC transporter permease protein |
| aglK |
|
|
|
|
|
|
|
Gene: PSPTO0886: Alpha-glucoside ABC transporter ATP-binding protein |
Alpha-glucoside ABC transporter ATP-binding protein |
| cscA |
Gene: Avin_51810: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
|
Gene: PFL_3237: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
|
|
Gene: PSPTO0885: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
| scrR |
Gene: Avin_51820: Sucrose utilization transcriptional regulator, LacI family |
|
|
Gene: PFL_3236: Sucrose utilization transcriptional regulator, LacI family |
|
|
|
Gene: PSPTO0884: Sucrose utilization transcriptional regulator, LacI family |
Sucrose utilization transcriptional regulator, LacI family |
| cscB |
*
Azotobacter vinelandii AvOP Site: position = -42 score = 5.1791 sequence = CGATGTTAACGTTACCTCAA Gene: Avin_51800: Sucrose permease, major facilitator superfamily |
|
|
*
Pseudomonas fluorescens Pf-5 Site: position = -42 score = 5.58221 sequence = CGATGTTAACGTTAACCTAA Gene: PFL_3238: Sucrose permease, major facilitator superfamily |
|
|
|
|
Sucrose permease, major facilitator superfamily |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |