Regulog ScrR - Pseudomonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Statistics of regulated genes
Genome	Genes	Operons
Azotobacter vinelandii AvOP	3	2
Pseudomonas aeruginosa PAO1
Pseudomonas entomophila L48
Pseudomonas fluorescens Pf-5	4	2
Pseudomonas mendocina ymp
Pseudomonas putida KT2440
Pseudomonas stutzeri A1501
Pseudomonas syringae pv. tomato str. DC3000	7	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
scrY	* Azotobacter vinelandii AvOP Site: position = -241 score = 5.1791 sequence = TTGAGGTAACGTTAACATCG Gene: Avin_51790: Sucrose-specific outer membrane porin	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	* Pseudomonas fluorescens Pf-5 Site: position = -185 score = 5.58221 sequence = TTAGGTTAACGTTAACATCG Gene: PFL_3239: Sucrose-specific outer membrane porin	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -96 score = 6.3774 sequence = AAAAGTTAACGTTAACATCG Gene: PSPTO0890: Sucrose-specific outer membrane porin	Sucrose-specific outer membrane porin

CRON 2.
aglE	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -46 score = 6.3774 sequence = CGATGTTAACGTTAACTTTT Gene: PSPTO0889: Alpha-glucoside ABC transporter periplasmic sugar-binding protein	Alpha-glucoside ABC transporter periplasmic sugar-binding protein
aglF	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0888: Alpha-glucoside ABC transporter permease protein	Alpha-glucoside ABC transporter permease protein
aglG	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0887: Alpha-glucoside ABC transporter permease protein	Alpha-glucoside ABC transporter permease protein
aglK	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0886: Alpha-glucoside ABC transporter ATP-binding protein	Alpha-glucoside ABC transporter ATP-binding protein
cscA	Azotobacter vinelandii AvOP Gene: Avin_51810: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5 Gene: PFL_3237: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0885: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)	Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
scrR	Azotobacter vinelandii AvOP Gene: Avin_51820: Sucrose utilization transcriptional regulator, LacI family	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5 Gene: PFL_3236: Sucrose utilization transcriptional regulator, LacI family	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0884: Sucrose utilization transcriptional regulator, LacI family	Sucrose utilization transcriptional regulator, LacI family
cscB	* Azotobacter vinelandii AvOP Site: position = -42 score = 5.1791 sequence = CGATGTTAACGTTACCTCAA Gene: Avin_51800: Sucrose permease, major facilitator superfamily	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	* Pseudomonas fluorescens Pf-5 Site: position = -42 score = 5.58221 sequence = CGATGTTAACGTTAACCTAA Gene: PFL_3238: Sucrose permease, major facilitator superfamily	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000	Sucrose permease, major facilitator superfamily

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog ScrR - Pseudomonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --