Regulon of ScrR in Azotobacter vinelandii AvOP

Properties
Regulator type:	Transcription factor
TF locus tag:	Avin_51820
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -241 Score: 5.2 Sequence: TTGAGGTAACGTTAACATCG Locus tag: Avin_51790 Name: scrY Funciton: Sucrose-specific outer membrane porin
	Avin_51790	scrY	Sucrose-specific outer membrane porin
Position: -42 Score: 5.2 Sequence: CGATGTTAACGTTACCTCAA Locus tag: Avin_51800 Name: cscB Funciton: Sucrose permease, major facilitator superfamily Locus tag: Avin_51810 Name: cscA Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
	Avin_51800	cscB	Sucrose permease, major facilitator superfamily
	Avin_51810	cscA	Sucrose-6-phosphate hydrolase (EC 3.2.1.26)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD