Regulog AAur_2567 - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Arthrobacter aurescens TC1 | 3 | 1 |
| Arthrobacter chlorophenolicus A6 | 3 | 1 |
| Arthrobacter sp. FB24 | ||
| Beutenbergia cavernae DSM 12333 | 6 | 1 |
| Brachybacterium faecium DSM 4810 | 3 | 1 |
| Brevibacterium linens BL2 | 3 | 1 |
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||
| Janibacter sp. HTCC2649 | ||
| Jonesia denitrificans DSM 20603 | 3 | 1 |
| Kocuria rhizophila DC2201 | 3 | 1 |
| Kytococcus sedentarius DSM 20547 | 3 | 1 |
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Renibacterium salmoninarum ATCC 33209 | 1 | 1 |
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| AAur_2567 |
*
Arthrobacter aurescens TC1 Site: position = -36 score = 7.00036 sequence = TATGGTTAGTTACATGAGTAATGAACCAGT Gene: AAur_2567: Transcriptional regulator, GntR family |
*
Arthrobacter chlorophenolicus A6 Site: position = -48 score = 6.46099 sequence = CATGGTTAGTTAGTCAAGTAAGTAACCAAC Gene: Achl_2889: Transcriptional regulator, GntR family |
|
*
Beutenbergia cavernae DSM 12333 Site: position = -48 score = 5.85161 sequence = CATGGTTCACTACTTACGTAATGAACCCCC Gene: Bcav_0486: Transcriptional regulator, GntR family |
*
Brachybacterium faecium DSM 4810 Site: position = -66 score = 6.4492 sequence = CATGGTTCATTAGTGGAGTAATGAACCAAC Gene: Bfae_06980: Transcriptional regulator, GntR family |
*
Brevibacterium linens BL2 Site: position = -45 score = 6.87521 sequence = CATGGTTAGTTAGTTGAGTAACTAACCAAC Gene: BlinB01001376: Transcriptional regulator, GntR family |
|
|
*
Jonesia denitrificans DSM 20603 Site: position = -36 score = 6.61921 sequence = ATAGGTTAGTTACATGAGTAATGAACCAGT Gene: Jden_1559: Transcriptional regulator, GntR family |
*
Kocuria rhizophila DC2201 Site: position = -46 score = 5.99614 sequence = TGTGGTTCCTTAGTAAAGTAATGAACCAAG Gene: KRH_20790: Transcriptional regulator, GntR family |
*
Kytococcus sedentarius DSM 20547 Site: position = -42 score = 6.8262 sequence = AATGGTTAGTTAGTCAAGTAACTAACTAAC Gene: Ksed_02920: Transcriptional regulator, GntR family |
|
*
Renibacterium salmoninarum ATCC 33209 Site: position = -72 score = 5.69572 sequence = TTAGGTTAGTTGTATGAGTAATGAACCGGC Gene: RSal33209_1480: Transcriptional regulator, GntR family |
|
Transcriptional regulator, GntR family |
| lp_2743 |
Gene: AAur_2566: ABC-type multidrug transport system, ATPase component |
Gene: Achl_2888: ABC-type multidrug transport system, ATPase component |
|
Gene: Bcav_0485: ABC-type multidrug transport system, ATPase component |
Gene: Bfae_06990: ABC-type multidrug transport system, ATPase component |
Gene: BlinB01001377: ABC-type multidrug transport system, ATPase component |
|
|
Gene: Jden_1558: ABC-type multidrug transport system, ATPase component |
Gene: KRH_20780: ABC-type multidrug transport system, ATPase component |
Gene: Ksed_02930: ABC-type multidrug transport system, ATPase component |
|
Gene: RSal33209_1481: ABC-type multidrug transport system, ATPase component |
|
ABC-type multidrug transport system, ATPase component |
| lp_2744 |
Gene: AAur_2565: ABC-type multidrug transport system, permease component |
Gene: Achl_2887: ABC-type multidrug transport system, permease component |
|
2
Beutenbergia cavernae DSM 12333 Gene: Bcav_0484: ABC-type multidrug transport system, permease component Gene: Bcav_0483: ABC-type multidrug transport system, permease component |
Gene: Bfae_07000: ABC-type multidrug transport system, permease component |
Gene: BlinB01001378: ABC-type multidrug transport system, permease component |
|
|
Gene: Jden_1557: ABC-type multidrug transport system, permease component |
Gene: KRH_20770: ABC-type multidrug transport system, permease component |
Gene: Ksed_02940: ABC-type multidrug transport system, permease component |
|
Gene: RSal33209_1482: ABC-type multidrug transport system, permease component |
|
ABC-type multidrug transport system, permease component |
| Bcav_0482 |
|
|
|
Gene: Bcav_0482: ABC transporter related |
|
|
|
|
|
|
|
|
|
|
ABC transporter related |
| Bcav_0481 |
|
|
|
Gene: Bcav_0481: ABC-2 type transporter |
|
|
|
|
|
|
|
|
|
|
ABC-2 type transporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |