Regulon of AAur_2567 in Renibacterium salmoninarum ATCC 33209

Properties
Regulator type:	Transcription factor
TF locus tag:	RSal33209_1480
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	AAur_2567 - Micrococcineae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 5.7 Sequence: TTAGGTTAGTTGTATGAGTAATGAACCGGC Locus tag: RSal33209_1480 Name: AAur_2567 Funciton: Transcriptional regulator, GntR family
	RSal33209_1480	AAur_2567	Transcriptional regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD