Regulon of AAur_2567 in Brachybacterium faecium DSM 4810
| Regulator type: | Transcription factor |
| TF locus tag: | Bfae_06980 |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Regulog: | AAur_2567 - Micrococcineae |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -66
Score: 6.4 Sequence: CATGGTTCATTAGTGGAGTAATGAACCAAC
Locus tag: Bfae_06980
Name: AAur_2567 Funciton: Transcriptional regulator, GntR family
Locus tag: Bfae_06990
Name: lp_2743 Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Bfae_07000
Name: lp_2744 Funciton: ABC-type multidrug transport system, permease component |
|||
|
AAur_2567
|
Transcriptional regulator, GntR family
|
||
|
lp_2743
|
ABC-type multidrug transport system, ATPase component
|
||
|
lp_2744
|
ABC-type multidrug transport system, permease component
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |