Regulog BgaR - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactosides utilization |
| Effector: | Beta-galactosides |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By TF family - LacI
- By effector - Beta-galactosides
- By pathway - Galactosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | 5 | 2 |
| Brevibacterium linens BL2 | ||
| Brachybacterium faecium DSM 4810 | ||
| Beutenbergia cavernae DSM 12333 | ||
| Arthrobacter sp. FB24 | ||
| Arthrobacter chlorophenolicus A6 | ||
| Arthrobacter aurescens TC1 | ||
| Janibacter sp. HTCC2649 | ||
| Jonesia denitrificans DSM 20603 | 5 | 2 |
| Kocuria rhizophila DC2201 | ||
| Kytococcus sedentarius DSM 20547 | ||
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Renibacterium salmoninarum ATCC 33209 | ||
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| bgaX |
Gene: CMM_2699: Putative beta-galactoside ABC transport system, periplasmic component |
|
|
|
|
|
|
|
*
Jonesia denitrificans DSM 20603 Site: position = -175 score = 6.34263 sequence = CGATGTTTGCGTAAACATGC Site: position = -143 score = 6.49988 sequence = AGATGTTGACGTAAACATCG Gene: Jden_0101: Putative beta-galactoside ABC transport system, periplasmic component |
|
|
|
|
|
Putative beta-galactoside ABC transport system, periplasmic component |
| bgaY |
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -94 score = 6.49988 sequence = AGATGTTTGCGCAAACACCC Gene: CMM_2697: Putative beta-galactoside ABC transport system, permease component 2 |
|
|
|
|
|
|
|
Gene: Jden_0102: Putative beta-galactoside ABC transport system, permease component 2 |
|
|
|
|
|
Putative beta-galactoside ABC transport system, permease component 2 |
| bgaZ |
Gene: CMM_2698: Putative beta-galactoside ABC transport system, permease component 1 |
|
|
|
|
|
|
|
Gene: Jden_0103: Putative beta-galactoside ABC transport system, permease component 1 |
|
|
|
|
|
Putative beta-galactoside ABC transport system, permease component 1 |
| bgaB |
Gene: CMM_2700: Beta-galactosidase (EC 3.2.1.23) |
|
|
|
|
|
|
|
Gene: Jden_0104: Beta-galactosidase (EC 3.2.1.23) |
|
|
|
|
|
Beta-galactosidase (EC 3.2.1.23) |
| CRON 2. | |||||||||||||||
| bgaR |
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -2 score = 6.49988 sequence = GGGTGTTTGCGCAAACATCT Gene: CMM_2696: Putative transcriptional regulator for beta-galactosides utilization, LacI family |
|
|
|
|
|
|
|
*
Jonesia denitrificans DSM 20603 Site: position = -143 score = 6.49988 sequence = CGATGTTTACGTCAACATCT Site: position = -111 score = 6.34263 sequence = GCATGTTTACGCAAACATCG Gene: Jden_0100: Putative transcriptional regulator for beta-galactosides utilization, LacI family |
|
|
|
|
|
Putative transcriptional regulator for beta-galactosides utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |