Regulon of BgaR in Clavibacter michiganensis subsp. michiganensis NCPPB 382

Properties
Regulator type:	Transcription factor
TF locus tag:	CMM_2696
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Regulog:	BgaR - Micrococcineae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -2 Score: 6.5 Sequence: GGGTGTTTGCGCAAACATCT Locus tag: CMM_2696 Name: bgaR Funciton: Putative transcriptional regulator for beta-galactosides utilization, LacI family
	CMM_2696	bgaR	Putative transcriptional regulator for beta-galactosides utilization, LacI family
Position: -94 Score: 6.5 Sequence: AGATGTTTGCGCAAACACCC Locus tag: CMM_2697 Name: bgaY Funciton: Putative beta-galactoside ABC transport system, permease component 2 Locus tag: CMM_2698 Name: bgaZ Funciton: Putative beta-galactoside ABC transport system, permease component 1 Locus tag: CMM_2699 Name: bgaX Funciton: Putative beta-galactoside ABC transport system, periplasmic component Locus tag: CMM_2700 Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23)
	CMM_2697	bgaY	Putative beta-galactoside ABC transport system, permease component 2
	CMM_2698	bgaZ	Putative beta-galactoside ABC transport system, permease component 1
	CMM_2699	bgaX	Putative beta-galactoside ABC transport system, periplasmic component
	CMM_2700	bgaB	Beta-galactosidase (EC 3.2.1.23)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD