Regulon of BgaR in Jonesia denitrificans DSM 20603

Properties
Regulator type:	Transcription factor
TF locus tag:	Jden_0100
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Regulog:	BgaR - Micrococcineae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -175 Score: 6.3 Sequence: CGATGTTTGCGTAAACATGC Position: -143 Score: 6.5 Sequence: AGATGTTGACGTAAACATCG Locus tag: Jden_0101 Name: bgaX Funciton: Putative beta-galactoside ABC transport system, periplasmic component Locus tag: Jden_0102 Name: bgaY Funciton: Putative beta-galactoside ABC transport system, permease component 2 Locus tag: Jden_0103 Name: bgaZ Funciton: Putative beta-galactoside ABC transport system, permease component 1 Locus tag: Jden_0104 Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23)
	Jden_0101	bgaX	Putative beta-galactoside ABC transport system, periplasmic component
	Jden_0102	bgaY	Putative beta-galactoside ABC transport system, permease component 2
	Jden_0103	bgaZ	Putative beta-galactoside ABC transport system, permease component 1
	Jden_0104	bgaB	Beta-galactosidase (EC 3.2.1.23)
Position: -143 Score: 6.5 Sequence: CGATGTTTACGTCAACATCT Position: -111 Score: 6.3 Sequence: GCATGTTTACGCAAACATCG Locus tag: Jden_0100 Name: bgaR Funciton: Putative transcriptional regulator for beta-galactosides utilization, LacI family
	Jden_0100	bgaR	Putative transcriptional regulator for beta-galactosides utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD