Regulog RhiR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnogalacturonides utilization |
| Effector: | Rhamogalacturonate oligosaccharides |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By effector - Rhamogalacturonate oligosaccharides
- By pathway - Rhamnogalacturonides utilization
| Genome | Genes | Operons |
|---|---|---|
| Erwinia carotovora subsp. atroseptica SCRI1043 | 7 | 2 |
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | ||
| Salmonella typhimurium LT2 | ||
| Serratia proteamaculans 568 | ||
| Yersinia pestis KIM |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| rhiL |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -116 score = 7.36602 sequence = TTAATGCAAATTTGCATTAA Gene: ECA3751: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
|
|
|
Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
| CRON 2. | |||||||||||||
| rhiX |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -152 score = 6.91744 sequence = TTAATGCAAATTTGCATTGT Gene: ECA3750: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| rhiN |
Gene: ECA3749: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) |
|
|
|
|
|
|
|
|
|
|
|
Rhamnogalacturonyl hydrolase (EC 3.2.1.172) |
| rhiK |
Gene: ECA3748: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
|
|
|
Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein |
| rhiG |
Gene: ECA3747: Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
|
|
|
|
|
|
|
|
|
|
|
Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
| rhiF |
Gene: ECA3746: Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
|
|
|
|
|
|
|
|
|
|
|
Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
| rhiR |
Gene: ECA3745: Predicted rhamnogalacturonides utilization transcriptional regulator, LacI family |
|
|
|
|
|
|
|
|
|
|
|
Predicted rhamnogalacturonides utilization transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |