Regulon of RhiR in Erwinia carotovora subsp. atroseptica SCRI1043

Properties
Regulator type:	Transcription factor
TF locus tag:	ECA3745
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnogalacturonides utilization
Effector:	Rhamogalacturonate oligosaccharides
Regulog:	RhiR - Enterobacteriales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Rhamogalacturonate oligosaccharides
By pathway - Rhamnogalacturonides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -116 Score: 7.4 Sequence: TTAATGCAAATTTGCATTAA Locus tag: ECA3751 Name: rhiL Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
	ECA3751	rhiL	Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Position: -152 Score: 6.9 Sequence: TTAATGCAAATTTGCATTGT Locus tag: ECA3750 Name: rhiX Funciton: hypothetical protein Locus tag: ECA3749 Name: rhiN Funciton: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) Locus tag: ECA3748 Name: rhiK Funciton: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein Locus tag: ECA3747 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: ECA3746 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1 Locus tag: ECA3745 Name: rhiR Funciton: Predicted rhamnogalacturonides utilization transcriptional regulator, LacI family
	ECA3750	rhiX	hypothetical protein
	ECA3749	rhiN	Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
	ECA3748	rhiK	Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein
	ECA3747	rhiG	Putatuve rhamnogalacturonides ABC transporter, permease component 2
	ECA3746	rhiF	Putatuve rhamnogalacturonides ABC transporter, permease component 1
	ECA3745	rhiR	Predicted rhamnogalacturonides utilization transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD