Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing rhiX gene

Properties
Regulog: RhiR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnogalacturonides utilization
Effector: Rhamogalacturonate oligosaccharides
Phylum: Proteobacteria/gamma
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -152
Score: 6.91744
Sequence: TTAATGCAAATTTGCATTGT
Locus tag: ECA3750
Name: rhiX
Funciton: hypothetical protein
Locus tag: ECA3749
Name: rhiN
Funciton: Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
Locus tag: ECA3748
Name: rhiK
Funciton: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein
Locus tag: ECA3747
Name: rhiG
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: ECA3746
Name: rhiF
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: ECA3745
Name: rhiR
Funciton: Predicted rhamnogalacturonides utilization transcriptional regulator, LacI family
rhiX-rhiN-rhiK-rhiG-rhiF-rhiR -152 6.9 TTAATGCAAATTTGCATTGT ECA3750