Regulog YcjW - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Escherichia coli str. K-12 substr. MG1655 | 9 | 2 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Serratia proteamaculans 568 | ||
| Salmonella typhimurium LT2 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | ||
| Yersinia pestis KIM | ||
| Enterobacter sp. 638 | 9 | 2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| sucP |
|
|
|
|
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -29 score = 6.27905 sequence = TCATGGGACCGCTACCACGG Gene: b1309: Putative sucrose phosphorylase (EC 2.4.1.7) |
|
|
|
|
|
|
*
Enterobacter sp. 638 Site: position = -16 score = 6.27905 sequence = TCGTGGGACCGCTACCATGG Gene: Ent638_2165: Putative sucrose phosphorylase (EC 2.4.1.7) |
Putative sucrose phosphorylase (EC 2.4.1.7) |
| ycjN |
|
|
|
|
Gene: b1310: Sugar ABC transport system, periplasmic binding protein YcjNN |
|
|
|
|
|
|
Gene: Ent638_2164: Sugar ABC transport system, periplasmic binding protein YcjNN |
Sugar ABC transport system, periplasmic binding protein YcjNN |
| ycjO |
|
|
|
|
Gene: b1311: Sugar ABC transport system, permease protein YcjO |
|
|
|
|
|
|
Gene: Ent638_2163: Sugar ABC transport system, permease protein YcjO |
Sugar ABC transport system, permease protein YcjO |
| ycjP |
|
|
|
|
Gene: b1312: Sugar ABC transport system, permease protein YcjP |
|
|
|
|
|
|
Gene: Ent638_2162: Sugar ABC transport system, permease protein YcjP |
Sugar ABC transport system, permease protein YcjP |
| ycjQ |
|
|
|
|
Gene: b1313: Uncharacterized zinc-type alcohol dehydrogenase-like protein YcjQ |
|
|
|
|
|
|
Gene: Ent638_2161: Uncharacterized zinc-type alcohol dehydrogenase-like protein YcjQ |
Uncharacterized zinc-type alcohol dehydrogenase-like protein YcjQ |
| ycjR |
|
|
|
|
Gene: b1314: Sugar phosphate isomerases/epimerases family protein YcjR |
|
|
|
|
|
|
Gene: Ent638_2160: Sugar phosphate isomerases/epimerases family protein YcjR |
Sugar phosphate isomerases/epimerases family protein YcjR |
| ycjS |
|
|
|
|
Gene: b1315: Uncharacterized oxidoreductase YcjS |
|
|
|
|
|
|
Gene: Ent638_2159: Uncharacterized oxidoreductase YcjS |
Uncharacterized oxidoreductase YcjS |
| ycjT |
|
|
|
|
Gene: b1316: Uncharacterized glycosyl hydrolase YcjT EC=3.2.1.- |
|
|
|
|
|
|
Gene: Ent638_2158: Uncharacterized glycosyl hydrolase YcjT EC=3.2.1.- |
Uncharacterized glycosyl hydrolase YcjT EC=3.2.1.- |
| CRON 2. | |||||||||||||
| ycjU |
|
|
|
|
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -33 score = 5.46814 sequence = CAATGGGACCGCTACCAAAC Gene: b1317: Beta-phosphoglucomutase (EC 5.4.2.6) |
|
|
|
|
|
|
|
Beta-phosphoglucomutase (EC 5.4.2.6) |
| CRON 3. | |||||||||||||
| Ent638_2157 |
|
|
|
|
|
|
|
|
|
|
|
*
Enterobacter sp. 638 Site: position = -33 score = 6.21293 sequence = TCATGGGACCGCTACCACGC Gene: Ent638_2157: Multiple sugar ABC transporter, ATP-binding protein |
Multiple sugar ABC transporter, ATP-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |