Regulon of YcjW in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_2155
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	YcjW - Enterobacteriales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 6.2 Sequence: TCATGGGACCGCTACCACGC Locus tag: Ent638_2157 Name: null Funciton: Multiple sugar ABC transporter, ATP-binding protein
	Ent638_2157		Multiple sugar ABC transporter, ATP-binding protein
Position: -16 Score: 6.3 Sequence: TCGTGGGACCGCTACCATGG Locus tag: Ent638_2165 Name: sucP Funciton: Putative sucrose phosphorylase (EC 2.4.1.7) Locus tag: Ent638_2164 Name: ycjN Funciton: Sugar ABC transport system, periplasmic binding protein YcjNN Locus tag: Ent638_2163 Name: ycjO Funciton: Sugar ABC transport system, permease protein YcjO Locus tag: Ent638_2162 Name: ycjP Funciton: Sugar ABC transport system, permease protein YcjP Locus tag: Ent638_2161 Name: ycjQ Funciton: Uncharacterized zinc-type alcohol dehydrogenase-like protein YcjQ Locus tag: Ent638_2160 Name: ycjR Funciton: Sugar phosphate isomerases/epimerases family protein YcjR Locus tag: Ent638_2159 Name: ycjS Funciton: Uncharacterized oxidoreductase YcjS Locus tag: Ent638_2158 Name: ycjT Funciton: Uncharacterized glycosyl hydrolase YcjT EC=3.2.1.-
	Ent638_2165	sucP	Putative sucrose phosphorylase (EC 2.4.1.7)
	Ent638_2164	ycjN	Sugar ABC transport system, periplasmic binding protein YcjNN
	Ent638_2163	ycjO	Sugar ABC transport system, permease protein YcjO
	Ent638_2162	ycjP	Sugar ABC transport system, permease protein YcjP
	Ent638_2161	ycjQ	Uncharacterized zinc-type alcohol dehydrogenase-like protein YcjQ
	Ent638_2160	ycjR	Sugar phosphate isomerases/epimerases family protein YcjR
	Ent638_2159	ycjS	Uncharacterized oxidoreductase YcjS
	Ent638_2158	ycjT	Uncharacterized glycosyl hydrolase YcjT EC=3.2.1.-

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD