Regulon of YcjW in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b1320
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	YcjW - Enterobacteriales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 5.5 Sequence: CAATGGGACCGCTACCAAAC Locus tag: b1317 Name: ycjU Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
	b1317	ycjU	Beta-phosphoglucomutase (EC 5.4.2.6)
Position: -29 Score: 6.3 Sequence: TCATGGGACCGCTACCACGG Locus tag: b1309 Name: sucP Funciton: Putative sucrose phosphorylase (EC 2.4.1.7) Locus tag: b1310 Name: ycjN Funciton: Sugar ABC transport system, periplasmic binding protein YcjNN Locus tag: b1311 Name: ycjO Funciton: Sugar ABC transport system, permease protein YcjO Locus tag: b1312 Name: ycjP Funciton: Sugar ABC transport system, permease protein YcjP Locus tag: b1313 Name: ycjQ Funciton: Uncharacterized zinc-type alcohol dehydrogenase-like protein YcjQ Locus tag: b1314 Name: ycjR Funciton: Sugar phosphate isomerases/epimerases family protein YcjR Locus tag: b1315 Name: ycjS Funciton: Uncharacterized oxidoreductase YcjS Locus tag: b1316 Name: ycjT Funciton: Uncharacterized glycosyl hydrolase YcjT EC=3.2.1.-
	b1309	sucP	Putative sucrose phosphorylase (EC 2.4.1.7)
	b1310	ycjN	Sugar ABC transport system, periplasmic binding protein YcjNN
	b1311	ycjO	Sugar ABC transport system, permease protein YcjO
	b1312	ycjP	Sugar ABC transport system, permease protein YcjP
	b1313	ycjQ	Uncharacterized zinc-type alcohol dehydrogenase-like protein YcjQ
	b1314	ycjR	Sugar phosphate isomerases/epimerases family protein YcjR
	b1315	ycjS	Uncharacterized oxidoreductase YcjS
	b1316	ycjT	Uncharacterized glycosyl hydrolase YcjT EC=3.2.1.-

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD