Regulog TalR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | L-talarate utilization |
| Effector: | L-talarate |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By effector - L-talarate
- By pathway - L-talarate utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | 2 | 2 |
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | ||
| Salmonella typhimurium LT2 | 3 | 2 |
| Serratia proteamaculans 568 | ||
| Yersinia pestis KIM |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| talR |
|
|
|
|
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -193 score = 6.1261 sequence = TAATGATTGCGCAATCACCA Gene: ECA0997: Predicted L-talarate-specific transcriptional regulator, LacI family |
|
|
|
|
*
Salmonella typhimurium LT2 Site: position = -296 score = 6.69514 sequence = AAATGATTGCGCTAACATTT Site: position = -143 score = 6.71116 sequence = AAATGATGGCGCTATCATTT Gene: STM3696: Predicted L-talarate-specific transcriptional regulator, LacI family |
|
|
Predicted L-talarate-specific transcriptional regulator, LacI family |
| CRON 2. | |||||||||||||
| talD |
|
|
|
|
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -33 score = 6.69514 sequence = AAATGTTAGCGCAATCATTT Site: position = -151 score = 6.1261 sequence = TGGTGATTGCGCAATCATTA Gene: ECA0998: L-talarate dehydratase (EC 4.2.1.-) |
|
|
|
|
*
Salmonella typhimurium LT2 Site: position = -195 score = 6.71116 sequence = AAATGATAGCGCCATCATTT Site: position = -42 score = 6.69514 sequence = AAATGTTAGCGCAATCATTT Gene: STM3697: L-talarate dehydratase (EC 4.2.1.-) |
|
|
L-talarate dehydratase (EC 4.2.1.-) |
| talP |
|
|
|
|
|
|
|
|
|
Gene: STM3698: Probable L-talarate transporter |
|
|
Probable L-talarate transporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |