Regulon of TalR in Erwinia carotovora subsp. atroseptica SCRI1043

Properties
Regulator type:	Transcription factor
TF locus tag:	ECA0997
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	L-talarate utilization
Effector:	L-talarate
Regulog:	TalR - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - L-talarate
By pathway - L-talarate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -151 Score: 6.1 Sequence: TGGTGATTGCGCAATCATTA Position: -33 Score: 6.7 Sequence: AAATGTTAGCGCAATCATTT Locus tag: ECA0998 Name: talD Funciton: L-talarate dehydratase (EC 4.2.1.-)
	ECA0998	talD	L-talarate dehydratase (EC 4.2.1.-)
Position: -193 Score: 6.1 Sequence: TAATGATTGCGCAATCACCA Locus tag: ECA0997 Name: talR Funciton: Predicted L-talarate-specific transcriptional regulator, LacI family
	ECA0997	talR	Predicted L-talarate-specific transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD