Regulon of TalR in Salmonella typhimurium LT2

Properties
Regulator type:	Transcription factor
TF locus tag:	STM3696
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	L-talarate utilization
Effector:	L-talarate
Regulog:	TalR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - L-talarate
By pathway - L-talarate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -296 Score: 6.7 Sequence: AAATGATTGCGCTAACATTT Position: -143 Score: 6.7 Sequence: AAATGATGGCGCTATCATTT Locus tag: STM3696 Name: talR Funciton: Predicted L-talarate-specific transcriptional regulator, LacI family
	STM3696	talR	Predicted L-talarate-specific transcriptional regulator, LacI family
Position: -195 Score: 6.7 Sequence: AAATGATAGCGCCATCATTT Position: -42 Score: 6.7 Sequence: AAATGTTAGCGCAATCATTT Locus tag: STM3697 Name: talD Funciton: L-talarate dehydratase (EC 4.2.1.-) Locus tag: STM3698 Name: talP Funciton: Probable L-talarate transporter
	STM3697	talD	L-talarate dehydratase (EC 4.2.1.-)
	STM3698	talP	Probable L-talarate transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD