Regulog SAV1329 - Streptomycetaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactosides utilization |
| Effector: | Beta-galactosides |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptomycetaceae
- By TF family - LacI
- By effector - Beta-galactosides
- By pathway - Galactosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Streptomyces avermitilis MA-4680 | 6 | 2 |
| Streptomyces coelicolor A3(2) | ||
| Streptomyces griseus subsp. griseus NBRC 13350 | ||
| Streptomyces scabiei 87.22 | 6 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| lacA |
*
Streptomyces avermitilis MA-4680 Site: position = -132 score = 7.14561 sequence = TTCTGTGAGCGTTCACAGTA Gene: SAV_1325: Beta-galactosidase (EC 3.2.1.23) |
|
|
*
Streptomyces scabiei 87.22 Site: position = -133 score = 7.14561 sequence = TTCTGTGAGCGTTCACAGTA Gene: SCAB_83491: Beta-galactosidase (EC 3.2.1.23) |
Beta-galactosidase (EC 3.2.1.23) |
| ganA |
Gene: SAV_1324: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) |
|
|
Gene: SCAB_83501: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) |
Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89) |
| CRON 2. | |||||
| SAV_1326 |
*
Streptomyces avermitilis MA-4680 Site: position = -73 score = 7.14561 sequence = TACTGTGAACGCTCACAGAA Gene: SAV_1326: Predicted galactosides ABC transporter, substrate-binding protein |
|
|
*
Streptomyces scabiei 87.22 Site: position = -73 score = 7.14561 sequence = TACTGTGAACGCTCACAGAA Gene: SCAB_83481: Predicted galactosides ABC transporter, substrate-binding protein |
Predicted galactosides ABC transporter, substrate-binding protein |
| SAV_1327 |
Gene: SAV_1327: Predicted galactosides ABC transporter, permease protein 1 |
|
|
Gene: SCAB_83471: Predicted galactosides ABC transporter, permease protein 1 |
Predicted galactosides ABC transporter, permease protein 1 |
| SAV_1328 |
Gene: SAV_1328: Predicted galactosides ABC transporter, permease protein 2 |
|
|
Gene: SCAB_83461: Predicted galactosides ABC transporter, permease protein 2 |
Predicted galactosides ABC transporter, permease protein 2 |
| SAV_1329 |
Gene: SAV_1329: Predicted galactosides utilization transcriptional regulator, LacI-family |
|
|
Gene: SCAB_83451: Predicted galactosides utilization transcriptional regulator, LacI-family |
Predicted galactosides utilization transcriptional regulator, LacI-family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |