Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SAV_1329 gene

Properties
Regulog: SAV1329 - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Actinobacteria
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -73
Score: 7.14561
Sequence: TACTGTGAACGCTCACAGAA
Locus tag: SAV_1326
Name: SAV_1326
Funciton: Predicted galactosides ABC transporter, substrate-binding protein
Locus tag: SAV_1327
Name: SAV_1327
Funciton: Predicted galactosides ABC transporter, permease protein 1
Locus tag: SAV_1328
Name: SAV_1328
Funciton: Predicted galactosides ABC transporter, permease protein 2
Locus tag: SAV_1329
Name: SAV_1329
Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family
SAV_1326-SAV_1327-SAV_1328-SAV_1329 -73 7.1 TACTGTGAACGCTCACAGAA SAV_1326
Streptomyces scabiei 87.22
Position: -73
Score: 7.14561
Sequence: TACTGTGAACGCTCACAGAA
Locus tag: SCAB_83481
Name: SAV_1326
Funciton: Predicted galactosides ABC transporter, substrate-binding protein
Locus tag: SCAB_83471
Name: SAV_1327
Funciton: Predicted galactosides ABC transporter, permease protein 1
Locus tag: SCAB_83461
Name: SAV_1328
Funciton: Predicted galactosides ABC transporter, permease protein 2
Locus tag: SCAB_83451
Name: SAV_1329
Funciton: Predicted galactosides utilization transcriptional regulator, LacI-family
SAV_1326-SAV_1327-SAV_1328-SAV_1329 -73 7.1 TACTGTGAACGCTCACAGAA SCAB_83481
© 2009-2020 RegPrecise