Regulog STM1555 - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 | 3 | 2 |
| Salmonella typhimurium LT2 | 2 | 1 |
| Proteus mirabilis HI4320 | ||
| Yersinia pestis KIM | ||
| Serratia proteamaculans 568 | 2 | 1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| STM1555 |
|
|
|
|
|
|
|
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -167 score = 6.90148 sequence = TCATGAAACCGGTTACATGA Gene: plu3734: Transcriptional regulator, LacI family |
|
|
|
|
Transcriptional regulator, LacI family |
| CRON 2. | |||||||||||||
| nhaX |
|
|
|
|
|
|
|
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -105 score = 6.21983 sequence = TTATGAAACCAATTACATGA Gene: plu3732: Predicted sugar transporter, Na+/H+ antiporter family |
*
Salmonella typhimurium LT2 Site: position = -95 score = 6.72491 sequence = TCATGTAATCGGTTACATGG Gene: STM1556: Predicted sugar transporter, Na+/H+ antiporter family |
|
|
*
Serratia proteamaculans 568 Site: position = -100 score = 6.64156 sequence = TCATGAAACCGATTACATGG Gene: Spro_3617: Predicted sugar transporter, Na+/H+ antiporter family |
Predicted sugar transporter, Na+/H+ antiporter family |
| malY |
|
|
|
|
|
|
|
Gene: plu3731: beta-cystathionase; Maltose regulon modulator |
Gene: STM1557: beta-cystathionase; Maltose regulon modulator |
|
|
Gene: Spro_3618: beta-cystathionase; Maltose regulon modulator |
beta-cystathionase; Maltose regulon modulator |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |