Regulon of STM1555 in Salmonella typhimurium LT2

Properties
Regulator type:	Transcription factor
TF locus tag:	STM1555
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	STM1555 - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -95 Score: 6.7 Sequence: TCATGTAATCGGTTACATGG Locus tag: STM1556 Name: nhaX Funciton: Predicted sugar transporter, Na+/H+ antiporter family Locus tag: STM1557 Name: malY Funciton: beta-cystathionase; Maltose regulon modulator
	STM1556	nhaX	Predicted sugar transporter, Na+/H+ antiporter family
	STM1557	malY	beta-cystathionase; Maltose regulon modulator

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD