Regulon of STM1555 in Photorhabdus luminescens subsp. laumondii TTO1

Properties
Regulator type:	Transcription factor
TF locus tag:	plu3733
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	STM1555 - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -167 Score: 6.9 Sequence: TCATGAAACCGGTTACATGA Locus tag: plu3734 Name: STM1555 Funciton: Transcriptional regulator, LacI family
	plu3734	STM1555	Transcriptional regulator, LacI family
Position: -105 Score: 6.2 Sequence: TTATGAAACCAATTACATGA Locus tag: plu3732 Name: nhaX Funciton: Predicted sugar transporter, Na+/H+ antiporter family Locus tag: plu3731 Name: malY Funciton: beta-cystathionase; Maltose regulon modulator
	plu3732	nhaX	Predicted sugar transporter, Na+/H+ antiporter family
	plu3731	malY	beta-cystathionase; Maltose regulon modulator

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD