Regulog MalR1 - Clostridia-1
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-1
- By TF family - LacI
- By effector - Maltose
- By pathway - Maltose utilization
- By pathway - Maltodextrin utilization
| Genome | Genes | Operons |
|---|---|---|
| Clostridium acetobutylicum ATCC 824 | ||
| Clostridium beijerincki NCIMB 8052 | 3 | 1 |
| Clostridium botulinum A str. ATCC 3502 | ||
| Clostridium butyricum 5521 | 3 | 1 |
| Clostridium kluyveri DSM 555 | ||
| Clostridium novyi NT | 8 | 1 |
| Clostridium perfringens ATCC 13124 | 4 | 1 |
| Clostridium tetani E88 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| malR1 |
|
*
Clostridium beijerincki NCIMB 8052 Site: position = -53 score = 6.06376 sequence = TTAAGGTAACGATACCGAAC Gene: Cbei_0863: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family |
|
*
Clostridium butyricum 5521 Site: position = -50 score = 6.34051 sequence = GAACGGTACCGTTACCGAAT Gene: CBY_3499: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family |
|
*
Clostridium novyi NT Site: position = -75 score = 6.10862 sequence = TACCAGTAACGTTTCCAAAA Gene: NT01CX_0963: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family |
*
Clostridium perfringens ATCC 13124 Site: position = -67 score = 6.34051 sequence = AACTGGTATCGTTACCGAAA Gene: CPF_2649: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family |
|
Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family |
| malK |
|
|
|
|
|
Gene: NT01CX_0964: Maltose/maltodextrin transporter, ATP-binding protein |
|
|
Maltose/maltodextrin transporter, ATP-binding protein |
| malE |
|
|
|
|
|
Gene: NT01CX_0965: Maltose/maltodextrin ABC transporter, substrate-binding protein |
|
|
Maltose/maltodextrin ABC transporter, substrate-binding protein |
| malF |
|
|
|
|
|
Gene: NT01CX_0966: Maltose/maltodextrin ABC transporter, permease protein 2 |
|
|
Maltose/maltodextrin ABC transporter, permease protein 2 |
| malG |
|
|
|
|
|
Gene: NT01CX_0967: Maltose/maltodextrin ABC transporter, permease protein 1 |
|
|
Maltose/maltodextrin ABC transporter, permease protein 1 |
| malZ |
|
|
|
|
|
Gene: NT01CX_0968: Alpha-glucosidase (EC 3.2.1.20) |
Gene: CPF_2648: Alpha-glucosidase (EC 3.2.1.20) |
|
Alpha-glucosidase (EC 3.2.1.20) |
| malQ |
|
Gene: Cbei_0864: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) |
|
Gene: CBY_3498: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) |
|
Gene: NT01CX_0969: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) |
Gene: CPF_2647: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) |
|
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) |
| glgP |
|
Gene: Cbei_0865: Maltodextrin phosphorylase (EC 2.4.1.1) |
|
Gene: CBY_3497: Maltodextrin phosphorylase (EC 2.4.1.1) |
|
Gene: NT01CX_0970: Maltodextrin phosphorylase (EC 2.4.1.1) |
Gene: CPF_2646: Maltodextrin phosphorylase (EC 2.4.1.1) |
|
Maltodextrin phosphorylase (EC 2.4.1.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |