Regulon of MalR1 in Clostridium novyi NT

Properties
Regulator type:	Transcription factor
TF locus tag:	NT01CX_0963
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR1 - Clostridia-1
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 6.1 Sequence: TACCAGTAACGTTTCCAAAA Locus tag: NT01CX_0963 Name: malR1 Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family Locus tag: NT01CX_0964 Name: malK Funciton: Maltose/maltodextrin transporter, ATP-binding protein Locus tag: NT01CX_0965 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: NT01CX_0966 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: NT01CX_0967 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: NT01CX_0968 Name: malZ Funciton: Alpha-glucosidase (EC 3.2.1.20) Locus tag: NT01CX_0969 Name: malQ Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) Locus tag: NT01CX_0970 Name: glgP Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
	NT01CX_0963	malR1	Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family
	NT01CX_0964	malK	Maltose/maltodextrin transporter, ATP-binding protein
	NT01CX_0965	malE	Maltose/maltodextrin ABC transporter, substrate-binding protein
	NT01CX_0966	malF	Maltose/maltodextrin ABC transporter, permease protein 2
	NT01CX_0967	malG	Maltose/maltodextrin ABC transporter, permease protein 1
	NT01CX_0968	malZ	Alpha-glucosidase (EC 3.2.1.20)
	NT01CX_0969	malQ	4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
	NT01CX_0970	glgP	Maltodextrin phosphorylase (EC 2.4.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD