Regulon of MalR1 in Clostridium beijerincki NCIMB 8052

Properties
Regulator type:	Transcription factor
TF locus tag:	Cbei_0863
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR1 - Clostridia-1
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 6.1 Sequence: TTAAGGTAACGATACCGAAC Locus tag: Cbei_0863 Name: malR1 Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family Locus tag: Cbei_0864 Name: malQ Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) Locus tag: Cbei_0865 Name: glgP Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
	Cbei_0863	malR1	Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family
	Cbei_0864	malQ	4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
	Cbei_0865	glgP	Maltodextrin phosphorylase (EC 2.4.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD