Regulog Bamb_4155 - Burkholderia

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By pathway - Sugar utilization

Statistics of regulated genes
Genome	Genes	Operons
Burkholderia cepacia AMMD	3	1
Burkholderia glumae BGR1
Burkholderia mallei ATCC 23344
Burkholderia phymatum STM815
Burkholderia pseudomallei K96243
Burkholderia sp. 383	3	1
Burkholderia vietnamiensis G4	3	1
Burkholderia xenovorans LB400

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
Bamb_4158	* Burkholderia cepacia AMMD Site: position = 43 score = 7.46874 sequence = CGTTGCACACGTGTGCAACG Gene: Bamb_4158: Sugar ABC transporter, substrate-binding protein	Burkholderia glumae BGR1	Burkholderia mallei ATCC 23344	Burkholderia phymatum STM815	Burkholderia pseudomallei K96243	* Burkholderia sp. 383 Site: position = 192 score = 7.46874 sequence = CGTTGCACACGTGTGCAACG Gene: Bcep18194_B0939: Sugar ABC transporter, substrate-binding protein	* Burkholderia vietnamiensis G4 Site: position = -59 score = 7.1044 sequence = CGCTGCACACGTGTGCAGTG Gene: Bcep1808_5293: Sugar ABC transporter, substrate-binding protein	Burkholderia xenovorans LB400	Sugar ABC transporter, substrate-binding protein
Bamb_4157	Burkholderia cepacia AMMD Gene: Bamb_4157: Sugar ABC transporter, permease protein 2	Burkholderia glumae BGR1	Burkholderia mallei ATCC 23344	Burkholderia phymatum STM815	Burkholderia pseudomallei K96243	Burkholderia sp. 383 Gene: Bcep18194_B0940: Sugar ABC transporter, permease protein 2	Burkholderia vietnamiensis G4 Gene: Bcep1808_5292: Sugar ABC transporter, permease protein 2	Burkholderia xenovorans LB400	Sugar ABC transporter, permease protein 2
Bamb_4156	Burkholderia cepacia AMMD Gene: Bamb_4156: Sugar ABC sugar transporter, inner membrane subunit	Burkholderia glumae BGR1	Burkholderia mallei ATCC 23344	Burkholderia phymatum STM815	Burkholderia pseudomallei K96243	Burkholderia sp. 383 Gene: Bcep18194_B0941: Sugar ABC sugar transporter, inner membrane subunit	Burkholderia vietnamiensis G4 Gene: Bcep1808_5291: Sugar ABC sugar transporter, inner membrane subunit	Burkholderia xenovorans LB400	Sugar ABC sugar transporter, inner membrane subunit

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Bamb_4155 - Burkholderia

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --