Regulog Bamb_4155 - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia cepacia AMMD | 3 | 1 |
| Burkholderia glumae BGR1 | ||
| Burkholderia mallei ATCC 23344 | ||
| Burkholderia phymatum STM815 | ||
| Burkholderia pseudomallei K96243 | ||
| Burkholderia sp. 383 | 3 | 1 |
| Burkholderia vietnamiensis G4 | 3 | 1 |
| Burkholderia xenovorans LB400 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| Bamb_4158 |
*
Burkholderia cepacia AMMD Site: position = 43 score = 7.46874 sequence = CGTTGCACACGTGTGCAACG Gene: Bamb_4158: Sugar ABC transporter, substrate-binding protein |
|
|
|
|
*
Burkholderia sp. 383 Site: position = 192 score = 7.46874 sequence = CGTTGCACACGTGTGCAACG Gene: Bcep18194_B0939: Sugar ABC transporter, substrate-binding protein |
*
Burkholderia vietnamiensis G4 Site: position = -59 score = 7.1044 sequence = CGCTGCACACGTGTGCAGTG Gene: Bcep1808_5293: Sugar ABC transporter, substrate-binding protein |
|
Sugar ABC transporter, substrate-binding protein |
| Bamb_4157 |
Gene: Bamb_4157: Sugar ABC transporter, permease protein 2 |
|
|
|
|
Gene: Bcep18194_B0940: Sugar ABC transporter, permease protein 2 |
Gene: Bcep1808_5292: Sugar ABC transporter, permease protein 2 |
|
Sugar ABC transporter, permease protein 2 |
| Bamb_4156 |
Gene: Bamb_4156: Sugar ABC sugar transporter, inner membrane subunit |
|
|
|
|
Gene: Bcep18194_B0941: Sugar ABC sugar transporter, inner membrane subunit |
Gene: Bcep1808_5291: Sugar ABC sugar transporter, inner membrane subunit |
|
Sugar ABC sugar transporter, inner membrane subunit |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |