Regulon of Bamb_4155 in Burkholderia vietnamiensis G4

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcep1808_5290
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Bamb_4155 - Burkholderia
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 7.1 Sequence: CGCTGCACACGTGTGCAGTG Locus tag: Bcep1808_5293 Name: Bamb_4158 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: Bcep1808_5292 Name: Bamb_4157 Funciton: Sugar ABC transporter, permease protein 2 Locus tag: Bcep1808_5291 Name: Bamb_4156 Funciton: Sugar ABC sugar transporter, inner membrane subunit
	Bcep1808_5293	Bamb_4158	Sugar ABC transporter, substrate-binding protein
	Bcep1808_5292	Bamb_4157	Sugar ABC transporter, permease protein 2
	Bcep1808_5291	Bamb_4156	Sugar ABC sugar transporter, inner membrane subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD