Regulon of Bamb_4155 in Burkholderia sp. 383

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcep18194_B0942
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Bamb_4155 - Burkholderia
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: 192 Score: 7.5 Sequence: CGTTGCACACGTGTGCAACG Locus tag: Bcep18194_B0939 Name: Bamb_4158 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: Bcep18194_B0940 Name: Bamb_4157 Funciton: Sugar ABC transporter, permease protein 2 Locus tag: Bcep18194_B0941 Name: Bamb_4156 Funciton: Sugar ABC sugar transporter, inner membrane subunit
	Bcep18194_B0939	Bamb_4158	Sugar ABC transporter, substrate-binding protein
	Bcep18194_B0940	Bamb_4157	Sugar ABC transporter, permease protein 2
	Bcep18194_B0941	Bamb_4156	Sugar ABC sugar transporter, inner membrane subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD