Regulog PFL_0254 - Pseudomonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Azotobacter vinelandii AvOP	1	1
Pseudomonas aeruginosa PAO1
Pseudomonas entomophila L48
Pseudomonas fluorescens Pf-5	2	2
Pseudomonas mendocina ymp
Pseudomonas putida KT2440
Pseudomonas stutzeri A1501
Pseudomonas syringae pv. tomato str. DC3000	1	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
PFL_0254	* Azotobacter vinelandii AvOP Site: position = -168 score = 6.06161 sequence = TTATGTCAGCGCTAACATGC Gene: Avin_21780: Transcriptional regulator, LacI family	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	* Pseudomonas fluorescens Pf-5 Site: position = -105 score = 6.83937 sequence = CTTTGTTAGCGCTAACATCG Gene: PFL_0254: Transcriptional regulator, LacI family	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -106 score = 6.90825 sequence = CGTTGTTAGCGCTAACATCG Gene: PSPTO0347: Transcriptional regulator, LacI family	Transcriptional regulator, LacI family

CRON 2.
omp	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	* Pseudomonas fluorescens Pf-5 Site: position = -24 score = 6.83937 sequence = CGATGTTAGCGCTAACAAAG Gene: PFL_0255: Hypothetical sugar outer membrane transporter, TonB-dependent	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000	Hypothetical sugar outer membrane transporter, TonB-dependent

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --