Regulon of PFL_0254 in Pseudomonas fluorescens Pf-5

Properties
Regulator type:	Transcription factor
TF locus tag:	PFL_0254
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	PFL_0254 - Pseudomonadaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 6.8 Sequence: CTTTGTTAGCGCTAACATCG Locus tag: PFL_0254 Name: PFL_0254 Funciton: Transcriptional regulator, LacI family
	PFL_0254	PFL_0254	Transcriptional regulator, LacI family
Position: -24 Score: 6.8 Sequence: CGATGTTAGCGCTAACAAAG Locus tag: PFL_0255 Name: omp Funciton: Hypothetical sugar outer membrane transporter, TonB-dependent
	PFL_0255	omp	Hypothetical sugar outer membrane transporter, TonB-dependent

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD