Regulon of PFL_0254 in Pseudomonas syringae pv. tomato str. DC3000
| Regulator type: | Transcription factor |
| TF locus tag: | PSPTO0347 |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | PFL_0254 - Pseudomonadaceae |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By TF family - LacI
- By pathway - Sugar utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -106
Score: 6.9 Sequence: CGTTGTTAGCGCTAACATCG
Locus tag: PSPTO0347
Name: PFL_0254 Funciton: Transcriptional regulator, LacI family |
|||
|
PFL_0254
|
Transcriptional regulator, LacI family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |