Regulog CadR-PbrR - Ralstonia
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Ralstonia
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Ralstonia solanacearum GMI1000 | 1 | 1 |
| Ralstonia pickettii 12J | 10 | 6 |
| Ralstonia metallidurans CH34 | 14 | 8 |
| Ralstonia eutropha JMP134 | 2 | 2 |
| Ralstonia eutropha H16 | 2 | 2 |
| Cupriavidus taiwanensis | 2 | 2 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| cadR |
|
|
*
Ralstonia metallidurans CH34 Site: position = -30 score = 5.8573 sequence = ACCCTGTAATTACTACAGGGA Gene: Rmet_3456: Cadmium resistance transcriptional regulator, MerR family |
*
Ralstonia eutropha JMP134 Site: position = -31 score = 5.68202 sequence = ACCCCGTAGTCACTACAGAGA Gene: Reut_A3299: Cadmium resistance transcriptional regulator, MerR family |
*
Ralstonia eutropha H16 Site: position = -42 score = 6.14485 sequence = ACCCTGTAGTAGTTACAGGGT Gene: H16_A3607: Cadmium resistance transcriptional regulator, MerR family |
*
Cupriavidus taiwanensis Site: position = -39 score = 6.12231 sequence = ACCCTGTAGTCGTTACAGGGT Gene: RALTA_A3062: Cadmium resistance transcriptional regulator, MerR family |
Cadmium resistance transcriptional regulator, MerR family |
| CRON 2. | |||||||
| pbrA |
|
*2
Ralstonia pickettii 12J Site: position = -63 score = 6.15292 sequence = ACTCTATAGTAGCTATAGAGT Gene: Rpic_1815: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Site: position = -65 score = 6.15292 sequence = ACTCTATAGTAGCTATAGAGT Gene: Rpic_1643: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*3
Ralstonia metallidurans CH34 Site: position = -26 score = 4.85391 sequence = ACTCTATATCTACTAGAGGTT Gene: Rmet_2303: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Site: position = -63 score = 6.1543 sequence = ACTCTATAGTAACTAGAGGGT Gene: Rmet_5947: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Site: position = -63 score = 6.1543 sequence = ACTCTATAGTAACTAGAGGGT Gene: pMOL30_091: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
| lspA |
|
2
Ralstonia pickettii 12J Gene: Rpic_1814: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Rpic_1644: Lipoprotein signal peptidase (EC 3.4.23.36) |
3
Ralstonia metallidurans CH34 Gene: Rmet_5948: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Rmet_2304: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: pMOL30_090: Lipoprotein signal peptidase (EC 3.4.23.36) |
|
|
|
Lipoprotein signal peptidase (EC 3.4.23.36) |
| pbrD |
|
|
Gene: Rmet_5949: Pb(II) binding protein |
|
|
|
Pb(II) binding protein |
| CRON 3. | |||||||
| pbrR |
|
*2
Ralstonia pickettii 12J Site: position = -43 score = 6.15292 sequence = ACTCTATAGCTACTATAGAGT Gene: Rpic_1642: Lead resistance transcriptional regulator, MerR family Site: position = -43 score = 6.15292 sequence = ACTCTATAGCTACTATAGAGT Gene: Rpic_1816: Lead resistance transcriptional regulator, MerR family |
*2
Ralstonia metallidurans CH34 Site: position = -44 score = 6.1543 sequence = ACCCTCTAGTTACTATAGAGT Gene: pMOL30_092: Lead resistance transcriptional regulator, MerR family Site: position = -44 score = 6.1543 sequence = ACCCTCTAGTTACTATAGAGT Gene: Rmet_5946: Lead resistance transcriptional regulator, MerR family |
|
|
|
Lead resistance transcriptional regulator, MerR family |
| pbrT |
|
2
Ralstonia pickettii 12J Gene: Rpic_1817: Pb(II) uptake protein, ILT family Gene: Rpic_1641: Pb(II) uptake protein, ILT family |
2
Ralstonia metallidurans CH34 Gene: pMOL30_093: Pb(II) uptake protein, ILT family Gene: Rmet_5945: Pb(II) uptake protein, ILT family |
|
|
|
Pb(II) uptake protein, ILT family |
| CRON 4. | |||||||
| Rpic_1752 |
|
*
Ralstonia pickettii 12J Site: position = -115 score = 5.97091 sequence = ACCCTGTAGTCACTACAGACT Gene: Rpic_1752: hypothetical protein |
*
Ralstonia metallidurans CH34 Site: position = -115 score = 5.97091 sequence = ACCCTGTAGTCACTACAGACT Gene: Rmet_5969: hypothetical protein |
|
|
|
hypothetical protein |
| CRON 5. | |||||||
| cadA |
*
Ralstonia solanacearum GMI1000 Site: position = -57 score = 5.64595 sequence = ACCCTGGAGTTCCTTCAGGGT Gene: RS05448: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Ralstonia pickettii 12J Site: position = -34 score = 5.63839 sequence = ACCCTGGAGCTTCTTCAGGGT Gene: Rpic_4809: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Ralstonia metallidurans CH34 Site: position = -46 score = 6.06593 sequence = ACCCTGTAGCGACTAAAGGGT Gene: Rmet_4594: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Ralstonia eutropha JMP134 Site: position = -61 score = 6.2636 sequence = ACTCTGTAGCGGCTACAGGGT Gene: Reut_B3972: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Ralstonia eutropha H16 Site: position = -61 score = 6.40785 sequence = ACTCTGTAGTCGCTACAGGGT Gene: H16_B1644: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Cupriavidus taiwanensis Site: position = -61 score = 6.40785 sequence = ACTCTGTAGCCACTACAGGGT Gene: RALTA_B1454: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |